Screening method for markerless deletion mutants of Hfq gene of Citrus canker
A technology of citrus canker and deletion mutants, which is applied in the field of molecular biology, can solve the problems of large workload, low efficiency, no markerless deletion mutants of the hfq gene of citrus canker, and achieves high screening efficiency and reduced workload. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment one, prepare experimental material
[0044] 1. The configuration of culture medium
[0045] The components of the liquid and solid medium used for E.coli cultivation are: Tryptone 10g / L, NaCl10g / L, Yeast Extract 5g / L, add water to dissolve, and finally adjust the volume to 1000mL, adjust the pH to 7.0-7.2, and pack After autoclaving. Add Agar 15g / L to LB solid medium.
[0046] The components of NA solid and NB liquid medium for Xanthomonas culture are: Polypeptone 5g / L, Sucrose 10g / L, Yeast Extract 1g / L, beef extract 3g / L, Agar 15g / L, dissolved in water , and finally set the volume to 1000mL, adjust the pH to 7.0-7.2, aliquot and autoclave, and remove Agar from the NB liquid medium.
[0047] 2. Main reagents and sources
[0048] Bacterial Genomic DNA Extraction Kit: Axygen, USA; Gel Recovery Kit, Plasmid Extraction Kit: Promega, USA; Southern Hybridization Kit: Roche, Germany; BamHI, KpnI, KpnI, XbaI, BMJM 109 Competent Cells, DH5α Large Intestine Bacill...
Embodiment 2
[0049] Example 2, Screening of X. citri hfq Gene Unmarked Deletion Mutants
[0050] Its process is as follows figure 1 As shown, follow the steps below:
[0051] 1. Genomic DNA extraction of X. citri
[0052] The total DNA of X. citri bacterial culture was extracted by Axygen Bacterial Genomic DNA Extraction Kit.
[0053] 2. Construction of recombinant suicide plasmid vector with deletion of hfq gene
[0054] 1. Amplification of the upstream and downstream flanking sequences of the hfq gene of X. citri
[0055] (1) Amplify the flanking sequence upstream of the hfq gene of X. citri, and the amplification primers are:
[0056] Hfq-up-F: TG GGATCC CGCGTGTTGAAGGTGGTATT (SEQ ID No: 1, the underline is the BamH I restriction site)
[0057] Hfq-up-R: TG GGTACC CGAAAAATCCTCTTCATTATTGT (SEQ ID No: 2, the underline is the KpnI restriction site)
[0058] Using the previously extracted genomic DNA of X. citri as a template, use primers Hfq-up-F and Hfq-up-R to amplify the upst...
Embodiment 3
[0157] Embodiment 3, comparison of traditional and improved sucrose medium screening mutant methods
[0158] 1. The traditional sucrose medium screening steps for mutants are as follows:
[0159] (1) Pick a single colony screened by Kan+sugar-free NA after electroporation, and transfer it to 3 mL sucrose-free NB medium for overnight culture at 28°C and 200 rpm.
[0160] (2) Transfer the bacterial solution amplified in the previous step to 10% sucrose NB medium at a ratio of 1:100 at 28°C and 200rmp for 3-4 passages;
[0161] (3) Dilute the bacterium solution with OD600=0.5 after passage for 10 1 、10 2 、10 3 、10 4 、10 5 , pipette 60μL and spread on 10% sucrose NA plate, culture at 28℃ for 72h;
[0162] (4) Streak the single colonies on the 10% sucrose NA plate to Kan+sugar-free NA (with resistance) and 10% sucrose NA (without resistance) plates one by one, draw 100 single colonies, and culture at 28°C for 36h, Observe the growth of the colony.
[0163] (5) Perform PCR v...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


