Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing genetic operation system of lysobacter gummosus OH17

A technology of colloidal lysobacteria and operating system, applied in the field of genetic engineering of microorganisms, can solve the problems of difficult construction of genetic operating system and different types of antibiotics, etc.

Inactive Publication Date: 2017-05-31
JIANGSU ACAD OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because lysobacteria are resistant to many antibiotics, and the types of antibiotics they are sensitive to are not the same, it is not easy to construct a genetic operating system for lysobacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing genetic operation system of lysobacter gummosus OH17
  • Method for constructing genetic operation system of lysobacter gummosus OH17
  • Method for constructing genetic operation system of lysobacter gummosus OH17

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: the construction method of a kind of Lysobacter colloidus OH17 genetic operating system of the present invention is as follows:

[0039] 1) Construction of gene knockout recombinant vector;

[0040] 1) Design a pair of primers for the upstream and downstream of the target gene, and use OH17 genomic DNA as a template for PCR amplification.

[0041] 2) Digest the recovered upstream and downstream fragments with endonucleases respectively, and connect them to the Bam HI / Xba I digested the plasmid pJQ200SK, and transformed it into Escherichia coli DH5α by heat shock.

[0042] 3) Use LA medium (Gm 25 μg / mL, X-gal 100 μg / mL) for screening, and verify by PCR and double enzyme digestion to obtain the correct recombinant vector.

[0043] 2) Construction of gene knockout mutants;

[0044] 1) Electroporate the recombinant vector into OH17 competent cells with a voltage of 1.8 kv.

[0045] 2) Spread the cells in LA medium containing 25 μg / mL gentamicin.

[00...

Embodiment 2

[0058] Embodiment 2: This embodiment illustrates that in Lysobacter colloidus OH17 pil R Gene knockout.

[0059] a) OH17 pil R Acquisition of gene sequence and design of primers;

[0060] Lysobacter zymogenes OH11 pil R The gene was used as a reference sequence, and the homologous sequence was located in the genome of OH17 through homologous alignment using BioEdit software. After alignment to the corresponding sequences, sequence analysis was performed using NCBI and SMART websites. Primers were designed using Primer Premier software, and the primer sequences were as follows:

[0061] pil R -F1: CGGGATCCGTCCGTTTCTTCACCACCTCCAG

[0062] pil R -R1: GGAATTCGTCGGTCAGGCACAAGTCGTAA

[0063] pil R -F2: GGAATTCGAAAACCGCTACAACAAGAC

[0064] pil R -R2:GCTCTAGAGAGTGGTGATTGAGTTGCTT

[0065] 2) Construction of gene knockout recombinant vector;

[0066] 1) PCR amplification pil R The upstream and downstream fragments of the gene, the recovered upstream and downstream ...

Embodiment 3

[0084] Embodiment 3: present embodiment illustrates that in Lysobacterium colloidus OH17 Lg2296 Gene knockout.

[0085] 1) Primer design;

[0086] According to the genome sequence analysis and comparison, the number in OH17 is Lg2296 Synthetic gene of antifungal substance HSAF in Lysobacter zymogenes OH11 PKS / NRPS Homologous, so the gene was selected for knockout, and the primers for the upstream and downstream fragments of the target gene were designed as follows:

[0087] Lg2296- F1: CGGGATCCAGGTGTCGCTGGCATTGATC

[0088] Lg2296- R1: CCCAAGCTTGAGGCTTTGCTGCTGGAATC

[0089] Lg2296- F2: CCCAAGCTTAGGGTGTGGGCGACGAACTG

[0090] Lg2296- R2: GCTCTAGATCCGACAGCCAGCCGTTGAG

[0091] 2) Construction of recombinant vectors;

[0092] 1) PCR amplification Lg2296 The upstream and downstream fragments of the gene, the recovered upstream and downstream fragments were used separately Bam HI / Hin dIII, Hin dIII / Xba I carry out enzyme digestion, and after the digestion...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a genetic operation system of lysobacter gummosus OH17. The method comprises the steps: extracting a genome from a lysobacter gummosus OH17 strain, carrying out PCR (Polymerase Chain Reaction) amplification on upstream and downstream fragments of a target gene, and connecting the fragments to suicidal plasmid, so as to construct a recombinant vector for gene knockout; enabling the recombinant vector to enter a competent cell of the OH17 in an electroporation manner, and carrying out homologous double exchange, so as to obtain a gene-knockout mutant; carrying out PCR amplification on a fragment containing a gene and a promoter thereof, connecting the amplified fragment to corresponding plasmid so as to obtain a recombinant vector of a back patching strain, introducing the recombinant vector of the back patching strain into a competent cell of the corresponding gene-knockout mutant through electroporation, and carrying out screening, thereby obtaining the back patching strain. According to the method, the genetic operation system of the OH17 is constructed, the gene knockout and complementation of the OH17 are achieved, and thus, a fundamental guarantee is provided for the molecular operation and gene function study of the strain.

Description

technical field [0001] The invention relates to the technical field of genetic engineering of microorganisms, in particular to a method for constructing a genetic operating system of Lysobacter colloidus OH17. Background technique [0002] Diseases caused by pathogenic fungi account for about 70-80% of plant diseases, and are one of the main obstacles to improving agricultural output, quality and benefit in our country. Chemical control is generally used to control fungal diseases in production. However, food quality and safety issues and ecological security issues caused by chemical pesticide residues have become the focus of attention from all walks of life. Therefore, the development of ecologically safe and environmentally friendly biopesticides is one of the effective ways to solve the above problems. [0003] In recent years, Lysobacterium as a class of potential biocontrol bacteria has received extensive attention. Lysobacterium ( Lysobacter spp) is a class of Gram...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21C12R1/01
CPCC12N15/74C12N2800/101
Inventor 徐会永刘凤权赵杨扬刘琳琳钱国良赵延存
Owner JIANGSU ACAD OF AGRI SCI