Histidine ammonia lyase and application thereof
A technology of histidine ammonia-lyase and application, applied in the field of biocatalysis, can solve the problems of high production cost, affecting product yield, large amount of enzyme, etc., and achieve the effect of reducing production cost and improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Construction of psHAL expression strain
[0040] The protein sequence of histidine ammonia lyase psHAL derived from Pseudoalteromonas sp.P1-26 (NCBI accession number: KPZ73722, SEQ ID NO: 1) was optimized for codon expression in Escherichia coli, and the gene sequence was fully synthesized (SEQ ID NO: 2). The synthetic gene was connected to GenScript standard vector pUC57 by Nanjing GenScript Company to obtain plasmid pUC57-psHAL.
[0041] Lyophilized plasmid pUC57-psHAL (4 μg) (from GenScript) was dissolved in 40 μl ddH 2 In O, it is used as a template to amplify the psHAL gene fragment, so that both ends of the gene have restriction sites NdeI and BamHI. Primers were designed as follows:
[0042] psHAL-NdeI-F: GGAATTCCATATGAGCGAGCACAGCACCAC;
[0043] psHAL-BamHI-R: CGGGATCCTTACGCATACAGGCTCCAAC.
[0044] The PCR reaction system includes: 1X KOD neo plus buffer, 0.2mM dNTP, 25mM MgSO 4 , psHAL-NdeI-F and psHAL-BamHI-R 50pmol each, pUC57-psHAL 50ng, KOD n...
Embodiment 2
[0047] Embodiment 2 Construction of ilPAL expression strain
[0048] Referring to the method disclosed in patent CN101517089A, a strain expressing phenylalanine ammonia-lyase ilPAL derived from Idiomarina loihiensis was constructed, and the obtained strain was named Top10 / pSE420-ilPAL.
Embodiment 3
[0049] Example 3 Construction of RgPAL expression strains
[0050] Referring to the method disclosed in patent CN101517089A, a strain expressing R. glutinis-derived phenylalanine ammonia-lyase RgPAL was constructed, and the obtained strain was named DH5α / pUC57-RgPAL.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
