A PCR reaction system and kit for high gc fragment amplification
A reaction system and kit technology, applied in the biological field, can solve the problems of unsuccessful amplification, high price, general applicability and poor market prospects, and achieve the effects of cost reduction and convenient purification.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1 A kind of PCR kit for amplification of DNA fragments with high GC content
[0060] Described PCR kit comprises:
[0061] (1) dNTPs, (2) Tris-HCl at pH 8.7, (3) MgSO 4 , (4) (NH 4 ) 2 SO 4 、 (5) BeCl 2 , (6) DMSO, (7) betaine, (8) DTT and (9) DNA polymerase.
Embodiment 2
[0062] Embodiment 2 A kind of PCR reaction system and its application for high GC content DNA fragment amplification
[0063] The INSR gene (NCBI No. AH002851.2) was used as the target amplified fragment and corresponding PCR primers were designed. The nucleic acid sequence of the target amplified product is:
[0064] CGCGGCCCCCAGCGCCTCTTGGGTGGCCGCCTCGGAGCATGACCCCCGCGGGCCAGCGCCGCGCGCTCTGATCCGAGGAGACCCCGCGCTCCCGCAGCCATGGGCACCGGGGGCCGGCGGGGAGCGGCGGCCGCGCCGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGC
[0065] The fragment length of the target amplification product is 180bp, and the GC content of the fragment is 82.8%.
[0066] (1) PCR primers are:
[0067] Upstream primer: 5'-CGCGGCCCCCAGCGCCTCTT-3'
[0068] Downstream primer: 5'-GCCCGCGGCGCCCAGTAGCA-3'.
[0069] (2) The PCR template is: the amplified sample is human whole blood.
[0070] (3) The PCR reaction system is:
[0071]
[0072] After the above reagents were added to the PCR tube, Taq DNA polymerase was added, and the...
Embodiment 3
[0078] Embodiment 3 A kind of PCR reaction system and its application for high GC content DNA fragment amplification
[0079] Target amplified fragment: same as Example 2.
[0080] (1) PCR primers: same as Example 2.
[0081] (2) PCR template: same as Example 2.
[0082] (3) PCR reaction system:
[0083]
[0084] After the above reagents were added to the PCR tube, Taq DNA polymerase was added, and the system was made up to 50 μL.
[0085] (4) Carry out PCR reaction according to the following PCR procedure:
[0086] 95℃, 10min;
[0087] 95°C, 15sec; 62°C, 15sec; 72°C, 30sec; 40 cycles;
[0088] 72°C, 45sec.
[0089] (5) Perform agarose gel electrophoresis on the PCR amplification products. Electrophoresis results such as figure 2 As shown, lanes 3 and 4 are the amplification products of this example. It can be clearly seen that the target DNA fragment with a GC content as high as 82.8% can be amplified using the amplification system of this example.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


