Check patentability & draft patents in minutes with Patsnap Eureka AI!

Promoter HLP4 induced by low temperature, high salinity, drought or ABA

A technology of HLP4 and promoters, which is applied in the field of plant bioengineering breeding and molecular biology, can solve the problems of cloning and application of unseen promoters, and achieve the effect of good development prospects and important application value

Active Publication Date: 2017-08-29
SHANDONG UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no related reports on the cloning and application of this promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter HLP4 induced by low temperature, high salinity, drought or ABA
  • Promoter HLP4 induced by low temperature, high salinity, drought or ABA
  • Promoter HLP4 induced by low temperature, high salinity, drought or ABA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Obtaining of the Arabidopsis HLP4 promoter

[0027] In order to obtain stress-inducible promoters, the inventors cloned the promoters of more than 100 genes from the Arabidopsis genome, and conducted large-scale screening for the activities of these promoters one by one. The HLP4 promoter was found to have strong stress-induced activity. The specific cloning process is described below.

[0028] 1) First, according to the Arabidopsis TAIR database, the regulatory sequence about 1.6 kb upstream of the translation initiation codon ATG of the HLP4 gene was selected as the HLP4 promoter sequence.

[0029] 2) According to the above sequence, use PRIMER5.0 software to design PCR amplification primers as follows.

[0030] HLP4-F: 5' AAGCTT GTTACACAACGTCATCAGATGAGTC 3';

[0031] HLP4-R:5' GGATCC GTCTAAAATCTATATGATGCCGCGG 3'.

[0032] A HindIII restriction site was added to the 5' end of the upstream primer, and a BamHI restriction site was added to the 5' end o...

Embodiment 2

[0037] The plant expression vector construction of embodiment 2 Arabidopsis HLP4 promoter and Agrobacterium transformation

[0038] The purpose is to obtain the vector expressing the glucuronidase reporter gene (GUS) driven by the HLP4 promoter, and to obtain the Agrobacterium containing the vector at the same time, so as to prepare for the subsequent transformation of Arabidopsis thaliana.

[0039] 1) The HLP4 promoter was cut out from the pMD-T18 intermediate vector with two restriction enzymes, HindIII and BamHI, and the pBI121 plant expression vector was also cut with the same two enzymes (the endonuclease was purchased from Takara Company, specifically For the conditions and procedures of enzyme digestion, please refer to its instructions). The digested product was recovered by agarose gel electrophoresis using a gel recovery kit from Tiangen Company (refer to the instruction manual).

[0040] 2) Ligate the obtained promoter fragment after digestion with the vector (use ...

Embodiment 3

[0043] Example 3 HLP4 promoter transforms Arabidopsis to verify that it is strongly induced by low temperature, high salinity, drought and ABA

[0044] The purpose is to transfer the HLP4 promoter-GUS expression vector into Arabidopsis thaliana to obtain transgenic plants for verifying whether the HLP4 promoter can be induced by adverse environmental conditions.

[0045] 1) Infect flower buds of Arabidopsis thaliana with Agrobacterium GV3101 containing a plant expression vector using the flower-dipping method (an open general method). After the siliques that grow out are mature, collect the T1 generation seeds and screen on the selection medium (MS medium with 30mg / L kanamycin added), and transplant the green transformed seedlings that can grow normally into the nutrient soil Cultivate, harvest the T2 generation seeds respectively, and then carry out the next round of kanamycin screening, and select the green seedlings:white seedlings in a 3:1 petri dish. The green seedlings ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter HLP4 induced by low temperature, high salinity, drought or ABA of arabidopsis. The nucleotide sequence of the promoter is as shown in SEQ ID No: 1, and the promoter is cloned from an arabidopsis genome by a PCR technology. The invention further discloses application of the promoter HLP4 in research of plant stress resistance genes or stress resistance gene engineering breeding. The promoter HLP4 constructs a plant expression vector of a reporter gene GUS to carry out plant transgenic operation so as to obtain a transgenic plant; and experiments prove that when the transgenic plant is treated under the conditions of low temperature, high salinity, drought and ABA, the expression activity of the reporter gene GUS is remarkably higher than the expression activity of a reporter gene GUS in a contrast group, it shows that the promoter HLP4 is a promoter which is highly induced by adverse situations, and the promoter HLP4 has huge application potential in research of stress resistance genes of plants and crop stress resistance breeding.

Description

technical field [0001] The invention belongs to the technical fields of plant bioengineering breeding and molecular biology, and relates to a plant promoter, in particular to a promoter HLP4 induced by low temperature, high salt, hyperosmosis or ABA of Arabidopsis thaliana and its application. Background technique [0002] During the growth and development of plants, they are often affected by harsh environments such as high temperature, low temperature, salinity, drought, waterlogging, etc., resulting in a significant reduction in crop yield. Although traditional breeding techniques can also obtain stress-resistant varieties through hybridization and screening, there are problems of low breeding efficiency, randomness, blindness, and uncertainty. With the rapid development of molecular biology, transgenic technology has provided new ideas and new methods for the cultivation of new crop varieties, and has various advantages such as convenience, target orientation, and short ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00
CPCC07K14/415C12N15/8222
Inventor 侯丙凯李燕洁李攀
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More