Construction method and application of toxoplasma lactate dehydrogenase gene knockout strain
A lactate dehydrogenase and gene knockout technology is applied in the field of construction and application of lactate dehydrogenase gene knockout strains of Toxoplasma gondii, and can solve the problem of toxoplasmosis prevention without a good vaccine and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1: Construction of Toxoplasma gondii △LDH1△LDH2 strain
[0020] (1) Starting strain ME49
[0021] ME49 is a type II worm strain of the genus Toxoplasma of the family Toxoplasma in the order Coccidia with two genes of lactate dehydrogenase 1 and lactate dehydrogenase 2. The nucleotide sequences of the lactate dehydrogenase 1 and 2 genes are as follows: Shown in SEQ ID NO: 1 and SEQ ID NO: 2.
[0022] (2) Construction of pSAG1-Cas9-TgU6-sgLDH2 plasmid
[0023] ① Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target gene targeting site, and design the gRNA primers according to the designed target sequence:
[0024] Upstream primer gRNA-LDH2-Fw:
[0025] 5’–AACCAGTATGAGAAGATCGCGTTTTAGAGCTAGAAATAGC–3’
[0026] The downstream primer (gRNA-R) is: 5'-AACTTGACATCCCCATTTAC-3'
[0027] ② Prepare the following reaction system in a sterilized PCR tube, in which the template DNA: pSAG1-Cas9-TgU6-sgUPRT plasmid (purchas...
Embodiment 2
[0090] Embodiment 2 Toxoplasma gondii △ LDH1 △ LDH2 worm strain purposes
[0091] 2.1 Gene knockout strain △LDH1△LDH2 diluted injection
[0092] 1) Dilute injection formula
[0093]
[0094] 2) Preparation method of diluted injection
[0095] ①Mix with a magnetic stirrer for 5 minutes.
[0096] ② Filter and sterilize with a 0.22um filter.
[0097] 2.2 Toxicity test of △LDH1△LDH2 double knockout strain on mice
[0098] 1) Use HFF cells to culture Toxoplasma gondii tachyzoites in vitro, until 30-50% of the parasites have escaped from the cells; discard the medium in the original culture bottle, and wash away the escaped parasites and residual medium with PBS , add fresh FBS-free dilution.
[0099] 2) Scrape off the cells with a disposable cell scraper, repeatedly blow and beat the suspension 8-10 times with a 5ml syringe, so that the insect vesicles burst and the worms escape, and filter and purify the worms with a sterile 3μm pore-diameter filter membrane; count the cel...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


