Miseq sequencing method for detecting helicobacter pylori gene and drug metabolism type
A Helicobacter pylori, metabotropic technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as failure, improper dosage of bacterial drug resistance, etc., and achieve rapid detection results, accurate accuracy, High throughput effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Design specific primers covering the regions of UreB, 23SrRNA, gyrA, CYP2C19*2, and CYP2C19*3 genes to be tested. The amplified product is 360-460bp. See Table 1 for details.
[0022] Table 1 Specific primers for gene regions to be tested
[0023]
[0024] Add the TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG linker sequence to the 5' end of each of the above forward primers, and add the GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG linker sequence to the 5' end of each reverse primer, see Table 2 for details.
[0025] Table 2 Primers containing linker sequences
[0026]
[0027]
[0028] 3. Dilute the above primers to 10 μM and then mix them. The mixing ratio of these primers in the Primer Pool is: A-23S: A-CYP2C19*2: A-CYP2C19*3: A-gyrA: A-UreB=2:0.5 :0.5:1:1.
[0029] 4. Synthesize the secondary amplification index primers from Illumina Company and dilute to 10uM. At present, there are 20 commonly used primers, including 12 N70X series and 8 S50Y series. There are 96 primer com...
Embodiment 2
[0033] Genome extraction from gastric mucosa
[0034] (1) In a sterile 2ml round bottom EP tube, add 100μl tissue lysate and a sterile steel ball with a diameter of 3mm;
[0035] (2) Take out the gastric mucosal tissue from the sample preservation solution, and transfer it to a 2ml round-bottomed EP tube containing the lysate and steel beads;
[0036] (3) The tissue grinder grinds the sample, and the parameters are 50 Hz and 60 s at room temperature until there is no tissue block;
[0037] (4) After fully grinding, briefly centrifuge, and transfer the homogenate liquid to a new sterile 1.5ml EP tube;
[0038] (5) Incubate the 1.5ml EP tube containing the homogenized tissue in a 95°C metal bath for 10 minutes, and invert it several times in the middle;
[0039] (6) Quickly incubate EP in a refrigerator at 4°C for 30 minutes;
[0040] (7) Take out the EP tube from the refrigerator, centrifuge at 12,000 rpm for 5 minutes, collect the supernatant into a new EP tube, and then ob...
Embodiment 3
[0042] Amplification and purification of target fragments
[0043] (1) Prepare the following reaction system with the PCR primers mixed according to the proportion: total reaction system 25 μl, including 12.5 μl of 2*PhusionHF Buffer PCR Master mix, 3.5 μl of template, 2 μl of mixed primer Primer Pool, ddH 2 O 7 μl. The reaction conditions were pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 30 seconds within the cycle, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, 20 cycles; extension at 72°C for 5 minutes after the cycle; storage at 10°C.
[0044](2) Add 20 μl Agencourt AMPure XP beads magnetic beads to 25 μL amplification product, pipette and mix, and place at room temperature for 5 minutes; put it on a magnetic rack, wait for 2-5 minutes until the liquid becomes clear, discard the supernatant, and slowly add freshly prepared Wash with 200 μl of 80% ethanol, discard the ethanol after 30 seconds, and repeat once; let the magnetic rack ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More