Method of preparing circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid)

A circular and circular molecule technology, applied in the field of nucleic acids, can solve the problems of low yield of single circular DNA or RNA, cumbersome processing steps, etc., to eliminate macromolecular by-products, the method is simple and easy to operate, and the preparation of high yield is achieved. Effect

Active Publication Date: 2017-10-20
OCEAN UNIV OF CHINA
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problems that the macromolecular by-products existing in the DNA or RNA circularization process increase sharply with the increase of the substrate concentration, the yield of a single circular DNA or RNA is low, and the post-processing steps are cumbersome, the present invention provides a circular The preparation method of DNA or RNA can reduce or eliminate the production of macromolecular by-products in the process of ring formation of single-stranded DNA or RNA at higher concentrations during the enzymatic ligation process assisted by DNA template strands, and improve the efficiency of DNA rings or RNA rings. Yield of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of preparing circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid)
  • Method of preparing circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid)
  • Method of preparing circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] 1) Raw materials

[0044] Circular strand (5'→3'): TCAGTGTTTTTTTCGTCGATTGCAGTAACTCCCCCAACCTCTTTTTCGATGCTTTTTTTGTGCGA (5'-phosphorylated, 66nt in length, SEQ ID NO: 1)

[0045] Contains restriction site T of Taq I on the circular chain ↓ CGA, so the formation of DNA circles can be confirmed by enzyme digestion experiments.

[0046] splint(5'→3'): CACTGATCGCAC (12nt in length, SEQ ID NO: 2)

[0047] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)

[0048] 2) connected into a ring

[0049] One-time ring formation: Add the ring-forming chain to the reaction system at one time. In the initial state, the concentration of the ring-forming chain in the system is 10 μM or 30 μM, the molar ratio of the ring-forming chain to splint is 1:2, 2.5U T4DNA Ligase / μM circular chain, 1×T4 DNA ligase buffer (Ligase Buffer), total volume 20 μL; ligate at 20°C for 8h.

[0050] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP...

Embodiment 2

[0060] 1) Raw material

[0061] Circular strand A (5'→3'): TAAGACACGTTGAGTTACATGAGCATCGTTCACAGCTCTATAGT GGCCTATT (5'-phosphorylated, 52nt in length, SEQ ID NO: 3)

[0062] splint A (5'→3'): GTCTTAAATAGGCC (14nt in length, SEQ ID NO: 4)

[0063] Circular strand B (5'→3'): GAATTAACGACTTAGAGCTGTGCTTTCTCAGTAATTTTTTTTTTTTTAGTCTC (5'-phosphorylated, 52nt in length, SEQ ID NO: 5)

[0064] splint B (5'→3'): TAATTCGAGACT (12nt in length, SEQ ID NO: 6)

[0065] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)

[0066] 2) connected into a ring

[0067] One-time ring formation: Add the circular strand to the system at one time for reaction. The initial state of the system contains 5μM circular strand DNA, 5μM splint, 10U T4DNA Ligase, 2×T4DNA Ligase Buffer, a total volume of 20μL; ligation at 16°C for 4h .

[0068] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP.

[0069] Cyclic formation by successive addition method: Re...

Embodiment 3

[0073] 1) Raw material

[0074] Circular strand (5'→3'): AACCGTGCGTGCGTGCGGATCAACTAATACGACTCATCATAA (5'-phosphorylated, 42nt in length, SEQ ID NO: 7)

[0075] splint (5'→3'): ACGGTTTTATGA (12nt in length, SEQ ID NO: 8)

[0076] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)

[0077] 2) connected into a ring

[0078] One-time loop formation: Add the looped chain to the reaction system at one time. The initial state of the system contains 4μM circularized strand DNA, 20μM splint, 10U T4DNA Ligase, 0.5×T4DNA Ligase Buffer, and a total volume of 20μL; ligate at 22°C 8h.

[0079] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP.

[0080] Cyclic formation by successive addition method: refer to the preparation steps of the successive addition method in Example 1 to prepare the initial system and the additive solution. The initial system contains 40μM splint, 0.5×T4DNA Ligase Buffer, 40U T4DNA Ligase, the total volum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of nucleic acid and particularly relates to a preparation method of high-concentration circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). The method comprises the following steps of: mixing assistant template DNA (hereinafter referred to as a splint), ligase and a buffer solution of the ligase required by a cyclic reaction to prepare an initial system, preparing an addition solution from single-stranded DNA or RNA (hereinafter referred to as a cyclic strand) and the buffer solution of the ligase, adding a certain amount of the addition solution containing the cyclic strand into the initial system every other certain time, allowing a concentration of the cyclic strand in the system to increase 0.1-5 micrometers after adding the new cyclic strand each time, repeating the procedure for several times, after adding the addition solution containing the cyclic strand for the last time, allowing for reaction for 2-15h, and allowing a concentration mole ratio of the splint to the cyclic strand in the system to be (1-10):1. The method is simple and easy to operate, does not require extreme conditions, and can achieve high yield preparation of circular DNA or RNA at the ultrahigh concentration of the cyclic strand (greater than or equal to 10 micrometers).

Description

technical field [0001] The invention belongs to the field of nucleic acid technology, and in particular relates to a method for preparing circular DNA or RNA. Background technique [0002] Nanotechnology is a new technology that uses molecules or atoms to construct manipulable nanoscale structures or machines. Nucleic acids are commonly used materials in nanotechnology due to their sequence programmability, ease of manipulation, and self-assembly. With the rapid development of nucleic acid self-assembly nanotechnology, the interlocking of circular DNA or RNA has gradually become another important branch of nucleic acid nanotechnology besides 2D and 3D DNA origami. This makes the properties of circular DNA or RNA and its topological structure gradually become a hotspot of attention. In addition, the research on the properties and topology of circular DNA or RNA is also closely related to the catalytic properties of DNAzyme and RNAzyme, rolling circle amplification, etc. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10
CPCC12N15/10
Inventor梁兴国安然李琦樊一乔
OwnerOCEAN UNIV OF CHINA