Method of preparing circular DNA (deoxyribonucleic acid) or RNA (ribonucleic acid)
A circular and circular molecule technology, applied in the field of nucleic acids, can solve the problems of low yield of single circular DNA or RNA, cumbersome processing steps, etc., to eliminate macromolecular by-products, the method is simple and easy to operate, and the preparation of high yield is achieved. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] 1) Raw materials
[0044] Circular strand (5'→3'): TCAGTGTTTTTTTCGTCGATTGCAGTAACTCCCCCAACCTCTTTTTCGATGCTTTTTTTGTGCGA (5'-phosphorylated, 66nt in length, SEQ ID NO: 1)
[0045] Contains restriction site T of Taq I on the circular chain ↓ CGA, so the formation of DNA circles can be confirmed by enzyme digestion experiments.
[0046] splint(5'→3'): CACTGATCGCAC (12nt in length, SEQ ID NO: 2)
[0047] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)
[0048] 2) connected into a ring
[0049] One-time ring formation: Add the ring-forming chain to the reaction system at one time. In the initial state, the concentration of the ring-forming chain in the system is 10 μM or 30 μM, the molar ratio of the ring-forming chain to splint is 1:2, 2.5U T4DNA Ligase / μM circular chain, 1×T4 DNA ligase buffer (Ligase Buffer), total volume 20 μL; ligate at 20°C for 8h.
[0050] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP...
Embodiment 2
[0060] 1) Raw material
[0061] Circular strand A (5'→3'): TAAGACACGTTGAGTTACATGAGCATCGTTCACAGCTCTATAGT GGCCTATT (5'-phosphorylated, 52nt in length, SEQ ID NO: 3)
[0062] splint A (5'→3'): GTCTTAAATAGGCC (14nt in length, SEQ ID NO: 4)
[0063] Circular strand B (5'→3'): GAATTAACGACTTAGAGCTGTGCTTTCTCAGTAATTTTTTTTTTTTTAGTCTC (5'-phosphorylated, 52nt in length, SEQ ID NO: 5)
[0064] splint B (5'→3'): TAATTCGAGACT (12nt in length, SEQ ID NO: 6)
[0065] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)
[0066] 2) connected into a ring
[0067] One-time ring formation: Add the circular strand to the system at one time for reaction. The initial state of the system contains 5μM circular strand DNA, 5μM splint, 10U T4DNA Ligase, 2×T4DNA Ligase Buffer, a total volume of 20μL; ligation at 16°C for 4h .
[0068] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP.
[0069] Cyclic formation by successive addition method: Re...
Embodiment 3
[0073] 1) Raw material
[0074] Circular strand (5'→3'): AACCGTGCGTGCGTGCGGATCAACTAATACGACTCATCATAA (5'-phosphorylated, 42nt in length, SEQ ID NO: 7)
[0075] splint (5'→3'): ACGGTTTTATGA (12nt in length, SEQ ID NO: 8)
[0076] Source: Synthetic (Suzhou Jinweizhi Biotechnology Co., Ltd.)
[0077] 2) connected into a ring
[0078] One-time loop formation: Add the looped chain to the reaction system at one time. The initial state of the system contains 4μM circularized strand DNA, 20μM splint, 10U T4DNA Ligase, 0.5×T4DNA Ligase Buffer, and a total volume of 20μL; ligate at 22°C 8h.
[0079] 1×T4 DNA Ligase Buffer composition: 40mM Tris-HCl (pH7.8@25℃), 10mM MgCl 2 , 10mM DTT, 0.5mM ATP.
[0080] Cyclic formation by successive addition method: refer to the preparation steps of the successive addition method in Example 1 to prepare the initial system and the additive solution. The initial system contains 40μM splint, 0.5×T4DNA Ligase Buffer, 40U T4DNA Ligase, the total volum...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



