Genetic engineering application of rice gene ORYsa;SIZ2
A technology of genetic engineering, rice, applied in the direction of genetic engineering, applications, DNA/RNA fragments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029]Embodiment 1, ORYsa; Identification of the expression pattern of OsSIZ2 gene
[0030] 1.1 Extraction and transcription of total RNA to synthesize the first strand of cDNA
[0031] The Nipponbare wild-type rice variety with uniform growth and seedling age of three weeks was selected and transplanted into potted pottery. The pot experiment was carried out at the archway base of Nanjing Agricultural University. (12 weeks) and filling stage (16 weeks) to take samples for expression analysis. Samples in the vegetative growth stage include: roots, rhizome junctions, leaf sheaths and leaves; samples in the reproductive growth stage are: roots, rhizome junctions, other leaf sheaths, other leaves, flag leaf sheaths, flag leaves, immature panicles, node 1 -3. Cob stalks, cobs and rice husks. Total RNA was extracted from the sampled samples using TriZol reagent, and the quality of total RNA was identified by agarose gel electrophoresis, and then the RNA content was determined on ...
Embodiment 2
[0040] Embodiment 2, ORYsa; The acquisition of RNAi and T-DNA insertion mutant material of OsSIZ2 gene
[0041] 2.1 ORYsa; Construction of OsSIZ2-RNAi vector
[0042] The carrier pTCK303 commonly used in this laboratory was selected as the RNAi carrier, according to (Wang, Z.A practical vector for efficient knockdown of gene expression in rice.Plant Molecular Biology Reporter.2004,22:409-417 Figure 8 ) literature method, according to the open reading frame (ORF) sequence of the OsSIZ2 gene, a part of the ORF fragment of the target gene was intercepted, and the primers for the RNAi expression vector were designed. Two restriction sites, BamH I and Kpn I, plus two protective bases are added to the 5' end of the forward primer; two restriction sites, Sac I and Spe I, plus three protective bases are added to the 5' end of the reverse primer base. The primer sequences are as follows:
[0043] Forward sequence: F: GGATCCTTAAGACGGCCACCTGTTTC (SEQ ID NO.4)
[0044] R: GTGGTACCGAG...
Embodiment 3
[0055] Example 3, ORYsa; Functional identification of OsSIZ2 gene in phosphorus nutrition
[0056] 3.1 Effects of partial silencing of OsSIZ2 on phosphorus uptake and transport during rice vegetative growth
[0057] In order to analyze the role of OsSIZ2 in the mechanism of phosphorus nutrient uptake and transport in rice, we conducted hydroponic experiments on the molecularly identified OsSIZ2-RNAi silencing materials. The 3-day-old OsSIZ2-RNAi silencing material and its wild-type seedlings with uniform growth were transplanted into normal phosphorus supply and phosphorus-deficient nutrient solutions. After 21 days, the plants were divided into two parts: leaves and roots. Extractable phosphorus concentration. It was found that under normal phosphorus supply conditions, the concentrations of extractable phosphorus in leaves and roots of OsSIZ2-RNAi silenced materials were significantly increased by 36-65% and 34-48% ( image 3 A); Under phosphorus deficiency conditions, the...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com