Aminotransferase, mutant and application to Sitagliptin preparation

A technology of aminotransferase and sitagliptin, which is applied in the preparation of chiral drug sitagliptin, can solve the problems of difficult recovery of solvents, poor stereoselectivity, and expensive catalysts, etc.

Active Publication Date: 2017-11-24
ZHEJIANG UNIV OF TECH +2
View PDF14 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at the problems of the reported asymmetric synthesis of sitagliptin and its intermediates with poor stereoselectivity, expensive catalysts, and difficult recovery of solvents, the invention provides a high catalytic activity, strong enantioselectivity, and solvent Aminotransferase with good tolerance enzymatically catalyzes the direct synthesis of sitagliptin, or an enzyme-chemical synthesis method for synthesizing sitagliptin intermediates and further synthesizing sitagliptin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aminotransferase, mutant and application to Sitagliptin preparation
  • Aminotransferase, mutant and application to Sitagliptin preparation
  • Aminotransferase, mutant and application to Sitagliptin preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1: Amplification of Aminotransferase Gene BgTA

[0053] Gladiolus Burkholderia (Burkholderia gladioli) ZJB-1216 is isolated from the soil, preserved in the China Center for Type Culture Collection (preservation number CCTCC NO: 2012379, has been disclosed in the patent application, application number CN201510026596 .7).

[0054] According to the aminotransferase gene sequencing information from Burkholderia sp. collected in Genbank, the Burkholderia gladioli ZJB-1216 cell was extracted with a rapid nucleic acid extraction instrument Using the genomic DNA as a template, PCR amplification was performed under the action of primer 1 (ATGGCTATCATCCAGGTTCAGCAGATC) and primer 2 (AGCCGGAACAGAAGAGAAGTATTC). PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 each at a concentration of 50 μM, 1 μL of genomic DNA , Pfu DNA Polymerase 1...

Embodiment 2

[0057] Embodiment 2: Construction of recombinant Escherichia coli BL21 / pET28b-BgTA

[0058] According to embodiment 1BgTA gene sequence design primer 3 (CCG CATATG GCTATCATCCAG

[0059] GTTCAGC), Primer 4 (TTG CTCGAG TCAAGCCGGAACAGAAGAG), and Nde I and Xho I restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the initiation of primer 3 and primer 4, the high-fidelity Pfu DNA polymerase was used to amplify, and the recombinant plasmid pMD18-T-BgTA was used as a template (obtained in Example 1) to obtain the BgTA gene sequence, which was sequenced using Nde I and The amplified fragment was treated with Xho I restriction endonuclease (TaKaRa), and the fragment was ligated with the commercial vector pET28b (Invitrogen) treated with the same restriction endonuclease using T4 DNA ligase (TaKaRa) to construct Expression vector pET28b-BgTA ( Figure 8 ). The constructed expression vector pET28b-BgTA was transformed into Escheric...

Embodiment 3

[0060] Example 3: Induced expression of aminotransferase (ω-BgTA)

[0061] The recombinant Escherichia coli BL21(DE3) / pET28b-BgTA obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37° C. for 12 hours at 200 rpm, and then treated with 1% (v / v) The inoculum is inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, cultivated at 37°C and 150 rpm until the OD of the bacteria 600 After reaching 0.6-0.8, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, centrifuge at 5000rpm at 4°C for 20min, discard the supernatant, collect the precipitate, and obtain recombinant Escherichia coli BL21 / pET28b-BgTA wet cells. The bacterium can be used directly as a biocatalyst or for protein purification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses aminotransferase, a mutant and application to Sitagliptin preparation. According to the application, wet thalli obtained by performing fermentation culture on recombinant escherichia coli containing aminotransferase encoding genes are used as biocatalysts; Sitagliptin precursor ketone is used as a substrate; dimethyl sulfoxide is used as a latent solvent; phosphopyridoxal is used as a coenzyme; isopropylamine is used as an auxiliary substrate; a trolamine buffer solution with the pH being 8 to 9 is used as a reaction medium; a reaction system is formed; the biocatalytic reaction is performed under the conditions of the temperature being 30 to 45 DEG C and the stirring speed being 100 to 250 r / min; after the reaction is completed, the reaction liquid is separated and purified; the Sitagliptin is obtained. The aminotransferase and the mutant are used as biocatalysts; the latent carbonyl compound of Sitagliptin precursor ketone is directly used as the substrate; meanwhile, biocatalytic reaction is performed by using isopropylamine as the auxiliary substrate and using the pyridoxal phosphate as the coenzyme; the separation and purification is performed; Sitagliptin with high optical purity is prepared. The method has the advantages that the total yield is 76 percent; the product e.e. value reaches 99 percent.

Description

(1) Technical field [0001] The present invention relates to an ω-aminotransferase gene, an encoding enzyme, a recombinant vector containing the gene, a recombinant genetically engineered bacterium transformed with the recombinant vector and a recombinant enzyme, and the ω-aminotransferase and its mutant enzymes in the preparation Application of chiral drug sitagliptin. (2) Background technology [0002] Sitagliptin (MK-0431) was developed and developed by Merck and Codexis in the United States. It is the first dipeptidyl peptidase-IV (DPP-IV) inhibitor approved by the FDA for the treatment of type 2 diabetes. (October 2016). DPP-IV is a multifunctional enzyme that exists on the cell membrane in the form of a homodimer, which can cleave a variety of peptide hormones including glucagon-like peptide-1 and gastric inhibitory peptide, which are related to Type 2 diabetes is closely linked. DPP-IV inhibitors reduce the degradation of GLP-1 by inhibiting DPP-IV and increase the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12P17/18
CPCC12N9/1096C12P17/182
Inventor何人宝郑裕国程峰柳志强金逸中汤晓玲邵鸿鸣张晓健周国斌林娇华张峰杨海龙
OwnerZHEJIANG UNIV OF TECH