Gene ZmSmk3 for encoding corn mTERF protein, cloning method and application thereof

A cloning method, corn technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems that the function of mTERF protein has not yet been resolved

Active Publication Date: 2017-12-15
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the mTERF genes reported in plants are concentrated in Arabidopsis. So far, the functions of most mTERF proteins have not been resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene ZmSmk3 for encoding corn mTERF protein, cloning method and application thereof
  • Gene ZmSmk3 for encoding corn mTERF protein, cloning method and application thereof
  • Gene ZmSmk3 for encoding corn mTERF protein, cloning method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Cloning of embodiment 1 ZmSmk3 mutant gene

[0066] There were 1 / 4 small-grain mutations in ZmSmk3 heterozygous selfed ears, and the wild type:mutant match was 3:1 (WT:Zmsmk3=1651:526, p=0.37), which proved that the mutant trait was controlled by a recessive single gene. The leaf DNA of 10 homozygous mutants (number: RS1-RS10) and 5 homozygous wild-type plants (number: RW1-5) were extracted by CTAB method. After the concentration was determined, all of them were diluted to 50ng / ul. 5. RS4-8 and RS6-10 were mixed in equal amounts to construct 3 homozygous mutant DNA pools; RW1-5 were mixed in equal amounts to construct a wild-type DNA pool, and the four mixed pools were respectively used as templates for subsequent PCR reactions.

[0067] Use thermal asymmetric staggered PCR, that is, use specific primers TIR9-1, TIR9-2 and random primers for the mu transposon end sequence in Table 5 to amplify. For specific amplification methods, refer to: Liu Wenting, 2006; Settles et ...

Embodiment 2

[0070] Example 2 Detection of mutant gene Zmsmk3 in individual maize plants

[0071] The sequence of the mutant gene Zmsmk3 was compared with the maize genome to find out the genomic position corresponding to the specific fragment. Centering on the insertion site of the matching position, design primers in combination with TIR6 to detect the genotype of a single plant. If the genotype and phenotype are co-segregated, the gene inserted at this site is the candidate gene, further expanding the population verification. The primer used in this paper to identify co-segregation is S21F / R. Its nucleotide sequence:

[0072] S21F: GGAGGAGCTGGTGTAGATCG

[0073] S21R:TACGTGCCAGATTTGATGCT

[0074] TIR6AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC

[0075] Genotype detection uses S21F / R, S21F+TIR6, S21R+TIR6, three pairs of primers to detect the genotype of each individual plant. If only S21F / R has a corresponding PCR product in the amplified bands of the three pairs of primers in a certain indiv...

Embodiment 3

[0090] Example 3 Expression Analysis and Subcellular Localization of ZmSmk3 Gene

[0091] The expression of ZmSmk3 gene in maize tissues was analyzed by qRT-PCR. ZmSmk3 is a constitutively expressed gene. ZmSmk3 gene is expressed in all vegetative and sexual reproductive tissues, and the expression level is relatively high in the stem, ear, ovary and embryo; the expression level is low in the root , leaves, tassels, filaments and endosperm, results such as Figure 5 Shown in A: qRT-PCR detection of the expression of ZmSmk3 in roots, stems, leaves, tassels, ears, filaments, ovaries, and embryos and endosperms of 15DAP. This result indicates that the ZmSmk3 gene is constitutively expressed in various stages of plant growth and development and in various tissues. At the same time, in the seeds 15 days after pollination, it was detected that the expression level of ZmSmk3 gene decreased in mutants (results such as Figure 5 B).

[0092] The gene was connected to the subcellula...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene ZmSmk3 for encoding corn mTERF protein and a cloning method for the gene ZmSmk3. The cloning method comprises the following steps of: respectively extracting DNA of a plurality of homozygous mutants and homozygous wild type plant leaves, mixing the extracted DNA of the homozygous mutants and constructing a DNA pool of the homozygous mutants; mixing the extracted wild type DNA and constructing a mild type DNA pool; respectively carrying out heat-asymmetric staggering PCR (Polymerase Chain Reaction) on the constructed DNA pool of the homozygous mutants and the wild type DNA pool to obtain PCR product segments; detecting obtained PCR amplification product segments by using agarose gel electrophoresis, recovering specific bands generated in the DNA pool of the homozygous mutants, and carrying out sequencing to obtain a sequence of the mutant gene ZmSmk3. The mutation of the gene ZmSmk3 for encoding the corn mTERF protein has an influence on the seed development progress, and the gene has an important guidance significance for breeding practice.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a gene ZmSmk3 encoding a corn mTERF protein and a cloning method and application thereof. Background technique [0002] Mitochondria are important energy conversion stations, which can efficiently convert the energy stored in organic matter into ATP (adenosine triphosphate), the direct energy source of cell life activities, and provide energy sources for life activities (Mackenzie and McIntosh, 1999; Gualberto et al., 2014). It has autonomous DNA replication, transcription and protein synthesis systems and is a semi-autonomous organelle. Among them, most mitochondrial proteins are encoded by the nucleus and are regulated by the nucleus. [0003] Mitochondrial gene expression is a complex biological process, including RNA (ribonucleic acid) transcription, RNA editing, intron splicing, RNA translation, maturation, and degradation (Hammani and Giegé, 2014). The m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00C12Q1/68
CPCC07K14/415C12N15/8261C12Q1/6895C12Q2600/13C12Q2600/158
Inventor邱法展任雪梅潘振远谭增栋秦瑶
OwnerHUAZHONG AGRI UNIV