Supercharge Your Innovation With Domain-Expert AI Agents!

Corn ZmPGIP-L gene and application thereof

A corn and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of little knowledge about PGIPs and achieve the effect of little environmental impact

Inactive Publication Date: 2017-12-22
YANGZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of PGIPs in maize remains poorly understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn ZmPGIP-L gene and application thereof
  • Corn ZmPGIP-L gene and application thereof
  • Corn ZmPGIP-L gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Molecular cloning of maize transcription factor ZmPGIP-L

[0036] Take three-leaf and one-core corn seedlings, the variety Zhengdan 958 (purchased from Yangzhou Tianyuan Seed Industry Co., Ltd.), quick-frozen in liquid nitrogen, and store in a refrigerator at -70°C for extraction of total RNA. Total RNA was extracted using TaKaRa's RNAiso Plus kit. Corn cDNA was synthesized according to the instructions of Fermentas' Revert Aid TM First Strand cDNA Synthesis Kit for first-strand synthesis.

[0037] The first strand of cDNA synthesized by the above kit was used as the amplification template, and the designed F: 5'CAGGAAAGAGCAAGATGAAGAC 3 (SEQ ID NO. 1)' and R: 5'GCAAAGACAGAGGCAATAATAG 3'(SEQ ID NO. 2) were used as primers. RT-PCR was used for cDNA amplification, and the amplification conditions were: 94℃, preheating for 5min; 94℃, 40s, 61℃, 40s, 72℃, 2 min, 35 cycles; 72℃, 10min. After PCR, electrophoresis analysis was performed, and the amplified fragment of abou...

Embodiment 2

[0039] Example 2: Expression profile analysis of transcription factor gene ZmPGIP-L under adversity stress

[0040] The hydroponic corn seedlings grown to the four-leaf and one-core stage are used for stress treatment. The seedlings under drought, high salt and ABA stress are placed in a solution containing 20% ​​PEG, 200 mM NaCl and 100 μM ABA, respectively. The seedlings were moved to a 4°C environment for cultivation. Under different stresses, cut seedling leaves at 0, 1, 3, 6, 12, 24, and 48 hours respectively. At least 10 seedlings should be taken at each time point. For each seedling, take the tip of the fourth fully expanded leaf. (Approximately 5 cm), quickly place in liquid nitrogen for quick freezing, and transfer to -70°C refrigerator for storage until RNA extraction. RNA extraction and cDNA synthesis are as described in Example 2. Fluorescence quantitative PCR was carried out on the 7500 quantitative PCR instrument of ABI company, with the designed F: 5'-GCAGTCGCTAC...

Embodiment 3

[0041] Example 3: Construction of plant expression vector for transcription factor gene ZmPGIP-L

[0042] The plasmid was extracted from the above-sequenced bacteria liquid, and the cloning vector plasmid containing the ZmPGIP-L gene was digested with BamH1+Kpn1, then a DNA fragment of about 1026 bp was recovered using a DNA recovery kit, and this fragment was digested with the corresponding p1011 The vectors are connected, and the obtained vector is named p1011-ZmPGIP-L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic breeding of crops, and specifically relates to a corn ZmPGIP-L gene and an application thereof. The corn ZmPGIP-L gene is a gene of the corn PGIP family, and has the sequence shown as SEQ ID NO.5. It is shown through functional analysis of paddy rice conversion that the sheath blight resistance of transgenic rice is improved, and the corn ZmPGIP-L gene can be applied to disease resistance transgenosis of other crops. The disease resistant gene comes from the plant itself, and has a small effect on the environment.

Description

Technical field [0001] The invention belongs to the field of crop genetic breeding, and specifically relates to the function and application of the corn gene ZmPGIP-L. Background technique [0002] Plants are constantly exposed to unfavorable environments, including abiotic stresses such as drought, salinity and low temperature, as well as biotic stresses caused by pathogens and pest attacks (Lorenzo et al., 2001). Rice (Oryza sativa) is the main food crop for humans, and more than 50% of the world's population depends on rice for most food needs. Like many other crops, a large number of pathogenic microorganisms cause important diseases in rice, leading to a significant decline in global production and threatening global food security. Rice blast (caused by the fungal pathogen Magnaporthe oryzae) and bacterial wilt (caused by the bacterial pathogen Xanthomonas Aspergillus oryzae) are the most destructive rice diseases. [0003] The cell wall is the first obstacle that plant cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
CPCC07K14/415C12N15/8282
Inventor 高勇陈建民梁恩兴张冬平吴美琴任小芸
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com