Nucleic acids, kit and method for simultaneously detecting four pathogens of blueberry diseases

A technology of pathogenic bacteria and blueberries, applied in the field of biotechnology detection, to achieve the effects of reducing pollution, high degree of automation, and avoiding labor

Active Publication Date: 2018-01-09
QINGDAO AGRI UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of high-efficiency fungicides and disease-resistant varieties for blueberry branch blight, canker, leaf spot and root cancer. Once these four diseases are found to be infected, the diseased trees need to be removed in time to prevent the spread of the disease. The management of pest-free areas prevents the invasion of these diseases. Therefore, it is particularly important to establish early and rapid detection methods for the pathogenic bacteria that cause blueberry branch blight, canker, leaf spot, root cancer and leaf spot.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acids, kit and method for simultaneously detecting four pathogens of blueberry diseases
  • Nucleic acids, kit and method for simultaneously detecting four pathogens of blueberry diseases
  • Nucleic acids, kit and method for simultaneously detecting four pathogens of blueberry diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The design of embodiment 1 primer, probe

[0054] Firstly, the specific target genes of the four pathogenic bacteria were screened separately. According to the purpose of detection, multiple gene sequences of the pathogenic bacteria that caused each disease were downloaded from GenBank, compared and analyzed, the conserved regions were selected, and the amplification primers were designed with the assistance of Array Designer4.0software software. And hybridization probes suitable for fluorescent quantitative PCR reaction system.

[0055] Since the present invention is a multiplex fluorescence quantification, the selection of probe labels is more critical at first, and secondly, the probes designed by the software must be screened, and the probe signals of the four genes cannot interfere with each other, so it is necessary to consider four pairs of genes when designing the probes. The primers and the four probes cannot interfere with each other.

[0056] Fluorescent qua...

Embodiment 2

[0076] Embodiment 2 Common PCR detects four kinds of pathogenic bacteria

[0077] The primer pair used for detecting branch blight pathogenic bacteria of the present invention, the positive sequence of its amplified product is shown in SEQ ID No.13, the size is 99bp, SEQ ID No.13: CGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTTCCAAGCCATTCTGCCGCTGCGCGGTAAGATTCTGAACGTTGAGAAAGCCAGACTTGATAAGA.

[0078]A pair of primers used to detect canker pathogenic bacteria, the positive sequence of the amplified product is shown in SEQ I D No. 14, the size is 166bp, SEQ ID No. 14: CCACACGAATTGCTTGATTCATTGAAGAAGACGATGAGAAGCAGCTTTTGCTTTGCACACCCGATTTTGGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCGAATCTGCCCAGACCCGTA.

[0079] For the primer pair used to detect the leaf spot pathogen, the positive sequence of the amplified product is shown in SEQ I D No. 15, with a size of 108 bp.

[0080] The primer pair used to detect root cancer pathogenic bacteria, the positive sequence of its amplified produ...

Embodiment 3

[0086] Embodiment 3 fluorescent quantitative PCR detection kit

[0087] Fluorescent quantitative PCR detection kits for detecting branch blight pathogens, canker pathogens, leaf spot pathogens and root cancer pathogens include the following components:

[0088] Premix EX Taq×2;

[0089] The upstream primer sequence for detecting branch blight pathogenic bacteria is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, the probe sequence is shown in SEQ ID No.3, and the sequence of the probe SEQ IDNo.3 5' mark JOE, 3' mark TAMRA;

[0090] The upstream primer sequence for detecting canker pathogenic bacteria is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6. Wherein, the probe sequence of SEQ ID No.6 5' mark Texred, 3' mark MGB;

[0091] The upstream primer sequence for detecting the leaf spot pathogen is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention relates to nucleic acids, a kit and a method which are used for simultaneously detecting four pathogens of blueberry diseases. The nucleic acids include upstream and downstream primers used for detecting the pathogen causing shoot blight, upstream and downstream primers used for detecting the pathogen causing canker, upstream and downstream primers used for detecting the pathogen causing leaf spot, and upstream and downstream primers used for detecting the pathogen causing crown-gall disease. The kit includes the specific primers and probes corresponding to the pathogens. The kitis convenient to use, high in detection specificity and high in sensitivity, and few agents are used. The invention also provides the method for detecting the four pathogens causing the shoot blight,the canker, the leaf spot and the crown-gall disease in blueberry. The method achieves detection of the four pathogens through one sample, thus greatly simplifying an operation process, reducing repeated operation steps, saving time, reducing labor for repeated operation, effectively saving the cost and achieving rapid screening.

Description

technical field [0001] The invention belongs to the field of biotechnology detection, and in particular relates to a kit and a method for simultaneously detecting four blueberry disease pathogenic bacteria. Background technique [0002] Blueberry (Vaccinium spp.), is a class of perennial small berry fruit trees belonging to Ericaceae (Ericaceae) Vaccinium (Vaccinium), widely used in medicine, health care, cosmetics and environmental protection, etc., the Food and Agriculture Organization of the United Nations will Its fruit is listed as one of the top five healthy foods in the human world, and it is also an economic crop worthy of development in the acid soil and hilly areas of southern my country. More than 10 provinces across the country have started large-scale commercial cultivation of blueberries, and it is expected to exceed 100,000 hectares in the next 10 years 2 . However, with the continuous expansion of production area, blueberry diseases are also becoming more an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
Inventor 李伟张翠萍
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap