Unlock instant, AI-driven research and patent intelligence for your innovation.

Araneus ventricosus wrapped fibroin full-length gene and preparation method thereof

A technology for full-length genetic, large-bellied garden spiders

Inactive Publication Date: 2018-02-16
DONGHUA UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the artificial biomimetic progress of spidroin fibers at home and abroad has been slow. Due to the characteristics of many types of spidroin proteins, large molecular weight, and high repeatability, it has been difficult to identify and clone the full-length coding genes of spidroin proteins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Araneus ventricosus wrapped fibroin full-length gene and preparation method thereof
  • Araneus ventricosus wrapped fibroin full-length gene and preparation method thereof
  • Araneus ventricosus wrapped fibroin full-length gene and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] (1) According to the conserved sequence at the NT end of the AcSp of other spiders, design a degenerate primer at the NT end and CT end respectively: NT end degenerate primer: TGTTTYCARGCNGTNATG, and design a specific reverse primer at the repeat region, Specific reverse primer: GCACCACTGGTCTGAGAGAAC; then perform PCR under the conditions of pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30s, annealing at 55°C for 30s, extension at 72°C for 30s, and 30 cycles.

[0044](2) According to the obtained sequence, two specific primers and one anchor primer were designed respectively at the NT end and CT end to complement the NT end and CT end.

[0045] NT end-specific primer 1: GACTTGTTGCTTGAAACGATGCTG;

[0046] NT end-specific primer 2: GCAGAGAAAAGCTCCTTGGTCTTG;

[0047] Anchor primer: ACTCCTGTGGAACC ATCGGACGGGGGG;

[0048] The anchor PCR conditions are: in the first round of PCR, use specific primer 1 for single primer amplification, conditions: pre-denat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an araneus ventricosus wrapped fibroin full-length gene and a preparation method thereof. The sequence of the gene is as shown in SEQ ID NO.1. The preparation method comprisesthe following steps: amplifying an NT sequence partially wrapping a fibroin protin by using a degenerate PCR (Polymerase Chain Reaction) method, complementing the NT sequence through anchoring PCR, designing a pair of primers according to the NT sequence obtained through sequencing and a CT sequence obtained from the NCBI (National Center of Biotechnology Information), performing PCR amplification on a full-length AcSp gene, performing blunt end cloning on a segment obtained through amplification, extracting plasmid of a positive cloning bacterium with the full-length AcSp gene, and performing full-length sequencing, so as to obtain the gene. The gene is an araneus ventricosus wrapped fibroin full-length gene with a complete NT end, a repeating area and a complete CT end, and has potential application values in the field of artificial spider thread fiber preparation.

Description

technical field [0001] The invention belongs to the field of spider silk protein genes, and in particular relates to a full-length gene of the enveloping silk protein of E. grandina and a preparation method thereof. Background technique [0002] Spider silk is a kind of natural protein silk fiber produced by spiders, which is the lifeline for its survival. Billions of years of evolution have endowed spider silk with excellent mechanical strength and biocompatibility. It is a high-quality, ideal Natural biological materials, comprehensive performance far surpasses silk and the best man-made fiber materials at present. It has great application value in the fields of high-performance fibers, composite materials and biomedical engineering materials. So far, the artificial biomimetic progress of spidroin fibers at home and abroad has been slow. Due to the characteristics of many types of spidroin proteins, large molecular weight, and high repeatability, the identification and cl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70
CPCC07K14/43518
Inventor 温睿孟清
Owner DONGHUA UNIV