Method for effectively enhancing sulfur oxidation performance of acidithiobacillus ferrooxidans

A technology of Thiobacillus ferrooxidans and sulfur oxidation, applied in the field of genetic engineering, can solve problems such as no reports

Inactive Publication Date: 2018-04-06
SHANDONG UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Acyl homoserine lactone (AHL for short) is a metabolite in the bacterial density sensing system. After retrieval, the ferrous oxide can be increased by overexpressing the acyl homoserin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for effectively enhancing sulfur oxidation performance of acidithiobacillus ferrooxidans
  • Method for effectively enhancing sulfur oxidation performance of acidithiobacillus ferrooxidans
  • Method for effectively enhancing sulfur oxidation performance of acidithiobacillus ferrooxidans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Construction of recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI)

[0032] 1. Construction of recombinant plasmid pJRD215-taq-afeI

[0033] (1) Genome extraction: Genome extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used to extract the genome of wild-type A. ferrooxidans bacteria for future use.

[0034] (2) Plasmid extraction: Plasmid pJRD215 was extracted using a plasmid extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) for future use.

[0035] (3) fusion of taq promoter and afeI fragment:

[0036]Using the plasmid containing the Taq promoter as a template, the primer pair was designed as follows, and the Taq promoter was obtained by PCR amplification;

[0037] Taq sen:TTTCCCAAGCTTGAATTCCGGC TCTAGA CGACATCATAACGGTTCTGG

[0038] (The underlined part is the XbaI restriction site)

[0039] Taq ant: GAATTTGTTTCCTGTGTGAAATTG

[0040] Using the A.ferrooxidans genome as a templa...

Embodiment 2

[0057] Comparative determination of the sulfur oxidation ability of embodiment 2 recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI) and contrast A.ferrooxidans (pJRD215)

[0058] Press 1×10 7 Inoculate the recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI) and the control A.ferrooxidans (pJRD215) into the same amount of fresh medium respectively at the initial inoculum amount of each / ml, culture at 30°C with shaking at 180rpm, and Time sampling was used to measure the growth of bacteria and the content of sulfate radical in the culture solution.

[0059] Bacterial growth process such as image 3 , showing that the lag period of the recombinant bacteria is shortened compared with the control, and the growth is better than that of the control strain; the content of sulfate radical changes as follows: Figure 4 , the content of sulfate in the culture solution of the recombinant bacteria was significantly higher than that of the control strain, indicating that the sulfur...

Embodiment 3

[0060] Example 3 Determination of the Effect of Adding Exogenous Acyl Homoserine Lactone on the Sulfur Oxidation Ability of A.ferroxidans

[0061] It was verified that adding exogenous acyl homoserine lactone (AHL) during the cultivation of wild-type A.ferrooxidans can improve the sulfur oxidation ability of A.ferrooxidans by increasing the content of AHL.

[0062] Press 1×10 7 The inoculum amount of A.ferrooxidans per ml was inoculated into a set amount of fresh medium, 30°C, 180rpm shaking culture, and 5.4×10 -3 ~10×10 -3 mg / mL of exogenous acyl homoserine lactone, with A.ferrooxidans without AHL as the control, the bacterial content was determined by turbidimetric method, and the growth status of the bacterial cells was as follows: Figure 5 , showing that the addition of acyl homoserine lactone can effectively enhance the growth of A.ferrooxidans under sulfur energy.

[0063] Above-mentioned homoserine lactone can also be prepared by the culture mode of recombinant bact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for effectively enhancing the sulfur oxidation performance of acidithiobacillus ferrooxidans. The method comprises the following steps: (1) constructing a recombinantbacterium A. ferrooxidans (pJRD215-taq-afeI), increasing the copy number of acyl homoserine lactone synthetase gene (afeI), by expressing afeI gene, increasing the content of acyl homoserine lactone (AHL) so as to enhance the sulfur oxidation performance of A. ferrooxidans; or (2) during the culture process of wild type A. ferrooxidans, adding exogenous acyl homoserine lactone (AHL) with a concentration of 5.4-10*10<3> mg/mL to enhance the sulfur oxidation performance of A. ferrooxidans through the increased content of AHL. The provided method has a wide application prospect in increasing theefficiency of industrial mineral leaching in the biological metallurgy field.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for effectively improving the sulfur oxidation ability of acidophilic Thiobacillus ferrooxidans, a dominant bacterium in ore leaching. Background technique [0002] Axidithiobacillus ferrooxidans (A.ferrooxidans for short) is a Gram-negative chemoautotrophic bacterium that can obtain energy by oxidizing ferrous iron or reducing sulfide, and uses the Calvin cycle to fix carbon dioxide as the main carbon source. Because acidophilic Thiobacillus ferrooxidans has two sets of energy metabolism systems, it has become one of the strains with the highest application value in the biometallurgical industry. [0003] Sulfide ores account for a large proportion of China's mineral resources, mainly chalcopyrite, pyrite, also known as pyrite, marcasite and so on. The primary link in the biometallurgical industry is to use the metabolic reaction of leaching microorganis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/74C12N1/38C12N1/20C12R1/01
CPCC12N1/20C12N1/38C12N15/74
Inventor 林建群高雪彦陈林旭林建强刘相梅庞昕王瑞
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap