Method for effectively enhancing sulfur oxidation performance of acidithiobacillus ferrooxidans
A technology of Thiobacillus ferrooxidans and sulfur oxidation, applied in the field of genetic engineering, can solve problems such as no reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1 Construction of recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI)
[0032] 1. Construction of recombinant plasmid pJRD215-taq-afeI
[0033] (1) Genome extraction: Genome extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used to extract the genome of wild-type A. ferrooxidans bacteria for future use.
[0034] (2) Plasmid extraction: Plasmid pJRD215 was extracted using a plasmid extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) for future use.
[0035] (3) fusion of taq promoter and afeI fragment:
[0036]Using the plasmid containing the Taq promoter as a template, the primer pair was designed as follows, and the Taq promoter was obtained by PCR amplification;
[0037] Taq sen:TTTCCCAAGCTTGAATTCCGGC TCTAGA CGACATCATAACGGTTCTGG
[0038] (The underlined part is the XbaI restriction site)
[0039] Taq ant: GAATTTGTTTCCTGTGTGAAATTG
[0040] Using the A.ferrooxidans genome as a templa...
Embodiment 2
[0057] Comparative determination of the sulfur oxidation ability of embodiment 2 recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI) and contrast A.ferrooxidans (pJRD215)
[0058] Press 1×10 7 Inoculate the recombinant bacteria A.ferrooxidans (pJRD215-taq-afeI) and the control A.ferrooxidans (pJRD215) into the same amount of fresh medium respectively at the initial inoculum amount of each / ml, culture at 30°C with shaking at 180rpm, and Time sampling was used to measure the growth of bacteria and the content of sulfate radical in the culture solution.
[0059] Bacterial growth process such as image 3 , showing that the lag period of the recombinant bacteria is shortened compared with the control, and the growth is better than that of the control strain; the content of sulfate radical changes as follows: Figure 4 , the content of sulfate in the culture solution of the recombinant bacteria was significantly higher than that of the control strain, indicating that the sulfur...
Embodiment 3
[0060] Example 3 Determination of the Effect of Adding Exogenous Acyl Homoserine Lactone on the Sulfur Oxidation Ability of A.ferroxidans
[0061] It was verified that adding exogenous acyl homoserine lactone (AHL) during the cultivation of wild-type A.ferrooxidans can improve the sulfur oxidation ability of A.ferrooxidans by increasing the content of AHL.
[0062] Press 1×10 7 The inoculum amount of A.ferrooxidans per ml was inoculated into a set amount of fresh medium, 30°C, 180rpm shaking culture, and 5.4×10 -3 ~10×10 -3 mg / mL of exogenous acyl homoserine lactone, with A.ferrooxidans without AHL as the control, the bacterial content was determined by turbidimetric method, and the growth status of the bacterial cells was as follows: Figure 5 , showing that the addition of acyl homoserine lactone can effectively enhance the growth of A.ferrooxidans under sulfur energy.
[0063] Above-mentioned homoserine lactone can also be prepared by the culture mode of recombinant bact...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com