Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection kit based on RPA for bovine viral diarrhea virus and applications of detection kit

A bovine viral diarrhea and kit technology, which is used in the detection kit for detecting bovine viral diarrhea virus, the kit for detecting whether it has bovine viral diarrhea virus, and the field of virus detection kits, which can solve the problem of inaccuracy. High specificity, simple operation and low instrument requirements

Inactive Publication Date: 2018-05-01
NORTHWEST UNIVERSITY FOR NATIONALITIES
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are many methods for detecting and diagnosing BVDV at home and abroad. Commonly used detection methods include virus isolation and culture, neutralization test, enzyme-linked immunosorbent assay, RT-PCR, etc., which are time-consuming, laborious, inaccurate, non-specific or sensitive. inferiority
Although conventional RT-PCR detection has improved the specificity of diagnosis, its sensitivity is insufficient, it can only be used for semi-quantitative or qualitative analysis, and it is easy to contaminate when a large number of samples are tested.
Although the real-time fluorescence quantitative RT-PCR technology has the advantages of high sensitivity, good repeatability, and high throughput, it has the disadvantages of prone to false positives and high equipment requirements, and is not easy to promote at the grassroots level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit based on RPA for bovine viral diarrhea virus and applications of detection kit
  • Detection kit based on RPA for bovine viral diarrhea virus and applications of detection kit
  • Detection kit based on RPA for bovine viral diarrhea virus and applications of detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] RPA detection kit and detection method for bovine viral diarrhea virus

[0047] (1) Screening of degenerate primers for RPA detection of bovine viral diarrhea virus

[0048] In order to obtain an efficient, accurate and rapid method for detecting BVDV virus, the applicant compared different strains of BVDV, and according to the sequence of BVDV registered in GenBack, 14 of them were BVDV type I, and the accession numbers were NC_001461, U86600, U86599、AF091605、AF268278、AB078952、AB078950、M96687、AJ585412、M96751、AF526381、DQ088995、EF101530和U63479;7株BVDV II型,登录号分别为AF002227、AY149216、AF502399、AY149215、FJ527854、GQ888686和AB567658。 The above sequences were compared and analyzed using Clustalx software, and a set of specific degenerate primers were designed in its 5' untranslated region.

[0049] After screening, the nucleotide sequence of the degenerate primer was obtained as follows:

[0050] UTR-F: 5'-GAGGCTAGCCATGCCCTTAGTAGGACTAGCAWA-3'

[0051] UTR-R: 5'-GGYYTCTGCWRCACCCTA...

Embodiment 2

[0074] Sensitivity Analysis of RPA Detection Method for Bovine Viral Diarrhea Virus

[0075] (1) Standard plasmid construction

[0076] Obtain the bovine viral diarrhea virus fragment ( figure 1 As shown, 246bp), the upstream degenerate primer is: UTR-F: 5'-GAGGCTAGCCATGCCCTTAGTAGGACTAGCAWA-3', the downstream degenerate primer is: UTR-R: 5'-GGYYTCTGCWRCACCCTATCAGGCTGTRTYCRT-3', and the nucleotide sequence of the target fragment is: gaggctagccatgcccttagtaggactagcatagcgaggggggtagcaacagtggtgagttcgttggatggcttaagccctgagtacagggtagtcgtcagtggttcgacgccttaacatgaaggtctcgagatgccacgtggacgagggcacgcccaaagcacatcttagcccgagcgggggtcgctcggacgaaaacagtttgatcaactgctacgaatacagcctgatagggtgctgcagagg。

[0077] figure 1 It is the target fragment of UTR obtained by RT-PCR method. M is a marker, 1 and 2 are RT-PCR results, and 3 is a negative control.

[0078] Insert the target fragment into the PMD18-T vector, construct the standard plasmid PMD18-T-UTR, use the plasmid mini-extraction kit to extract P...

Embodiment 3

[0091] Specific Analysis of RPA Detection Kit for Bovine Viral Diarrhea Virus

[0092] Select 4 types of bovine virus: bovine parvovirus, bovine parainfluenza virus, bovine adenovirus and reovirus; select 4 strains of bovine viral diarrhea virus type I: C24V, GSTZ, Av69 and S183; select 1 strain of bovine viral diarrhea virus Diarrhea virus type II: BVDV-2.

[0093] Use the RPA detection kit and detection method of the present invention to detect the above-mentioned several pathogens respectively, and simultaneously use the standard in Example 2 as a positive control, and use water as a negative control. See the test results image 3 .

[0094] image 3 In order to apply the RPA of the present invention to detect BVDV method-specific detection results. Among them, 1 and 2 are negative controls, 3-6 are bovine parvovirus, bovine parainfluenza virus, bovine adenovirus and reovirus respectively, and 7-11 are BVDV C24V, BVDVGSTZ, BVDV Av69, BVDV S183, BVDV-II .

[0095] Depend...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer pair for detecting a bovine viral diarrhea virus. The primer pair is as follows: UTR-F: 5'-GAGGCTAGCCATGCCCTTAGTAGGACTAGCAWA-3 ', and UTR-R: 5 '-GGYYTCTGCWRCACCCTATCAGGCTGTRTYCRT-3', wherein W, Y and R are degenerate base groups, W is A or T, Y is C or T, and R is A or G. The RPA primer pair disclosed by the invention can be used for effectively amplifying a targetgene, the specificity is high, the sensitivity is 6*10<3>copies / [mu] l. The RPA detection method provided by the invention can be widely applied to diagnosis for bovine diarrhea and detection for BVDVpathogens in the livestock breeding industry, and has great significance in the sound development of the breeding industries of cattle, pig, camel and like and the serum industry.

Description

technical field [0001] The invention belongs to the technical field of biotechnology, and in particular relates to a virus detection kit, in particular to a kit for detecting bovine viral diarrhea virus from animal tissues or blood samples. More specifically, the present invention is a detection kit for detecting bovine viral diarrhea virus (BVDV) from animal tissue or blood samples developed by using recombinase polymerization (RPA). Background technique [0002] Bovine Viral Diarrhea virus (BVDV), also known as Bovine Viral Diarrhea-Mucosal Disease Virus (BVD-MDV), is a widely distributed animal health hazard worldwide. important pathogens. More and more studies have shown that in addition to cattle, susceptible animals, sheep, goats, deer, camels and other wild ruminants are also susceptible hosts of BVDV. The clinical symptoms caused by BVDV mainly include bovine viral diarrhea, acute and chronic mucosal disease, immune tolerance and persistent infection, immunosuppres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2521/507C12Q2563/107C12Q2565/125Y02A40/70
Inventor 马忠仁马晓霞马鹏李明生曹欣常秋燕周小凯张德荣
Owner NORTHWEST UNIVERSITY FOR NATIONALITIES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com