CrRNA specifically targeting toward human RSPO2 gene in CRISPR-Cas13a system and system and application
A specific and genetic technology, applied in the field of crRNA and its system and application, can solve the problems that have not yet been applied in the diagnosis of liver fibrosis, and achieve the effect of fast detection speed and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Example 1 crRNA sequence design
[0073] Since the design of crRAN of CRISPR-Cas13a is different from the design of sgRNA of CRISPR-Cas9 system, there is no clear design principle of CRISPR-Cas13a crRNA. According to our previous work and experience, the design principles of crRNA targeting human RSPO2 gene are as follows: (1) crRNA includes spacer sequence and direct repeat sequence; (2) the length of crRNA spacer sequence is 22-28 base sequences; (3) the target point of crRNA spacer sequence on RSPO2 gene is located in the exon of the gene; (4) The PFS at the 3'end of the target sequence paired with the crRNA spacer sequence should not be G; (5) There is a seed region in the middle of the crRNA spacer sequence, and no mismatches can occur when combined with the target sequence (6) The direct repeat sequence of crRNA The length is greater than 24 base sequences; (7) The direct repeat sequence of crRNA should contain a stem loop structure. The crRNA in this example can b...
Embodiment 2
[0078] Example 2 crRNA sequence selection
[0079] Use Blast (www.ncbi.nlm.nig.gov / Blast) to perform homology analysis of candidate crRNA sequences and genome databases to ensure that the target sequence of the designed crRNA is unique and will not be homologous to other gene sequences other than the human RSPO2 gene . At the same time, the crRNA was screened according to the following principles to obtain the crRNA sequence for the efficient and specific detection of human RSPO2 gene: (1) The crRNA target cannot be too close to the start codon (ATG); (2) Off-Target rate low.
[0080] According to the above method, four crRNA spacer sequences targeting human RSPO2 gene were screened for different sites. The four target sequences are shown in SEQ ID NOs. 1, 5, 9, and 13 in the sequence table, and the crRNA spacer sequence corresponding to each target sequence is shown in SEQ ID NO. 2, 6, 10, and 14 in the sequence table. The target sequence, The crRNA spacer sequence and the cor...
Embodiment 3
[0081] Example 3 crRNA to synthesize DNA
[0082] For the convenience of storage and amplification in subsequent experiments, the present invention synthesizes crRNA into DNA and transcribes it into RNA in vitro during use: (1) According to the selected crRNA spacer sequence, add GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC to the 5` end (direct repeat corresponding to LwCas13a protein) Sequence) or CCACCCCAAUAUCGAAGGGGACUAAAAC (the direct repeat sequence corresponding to the LshCas13a protein) to obtain the crRNA sequence; (2) The crRNA sequence format is:
[0083] 5`-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-crRNA spacer sequence-3`; (LwCas13a)
[0084] or
[0085] 5`-CCACCCCAAUAUCGAAGGGGACUAAAAC-crRNA spacer sequence-3`; (LshCas13a)
[0086] (3) Add the T7 promoter sequence (TAATACGACTCACTATAGGG) in 5`, the DNA sequence format is as follows:
[0087] Forward sequence (LwCas13a):
[0088] 5`-TAATACGACTCACTATAGGG-GATTTAGACTACCCCAAAAACGAA GGGGACTAAAAC-crRNA DNA sequence corresponding to the spacer ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap