Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CrRNA specifically targeting toward human RSPO2 gene in CRISPR-Cas13a system and system and application

A specific and genetic technology, applied in the field of crRNA and its system and application, can solve the problems that have not yet been applied in the diagnosis of liver fibrosis, and achieve the effect of fast detection speed and low cost

Active Publication Date: 2018-05-18
JIAXING NO 1 HOSPITAL
View PDF0 Cites 39 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main application areas of liquid biopsy are blood detection of tumors and non-invasive prenatal diagnosis, but there is no application in the diagnosis of liver fibrosis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CrRNA specifically targeting toward human RSPO2 gene in CRISPR-Cas13a system and system and application
  • CrRNA specifically targeting toward human RSPO2 gene in CRISPR-Cas13a system and system and application
  • CrRNA specifically targeting toward human RSPO2 gene in CRISPR-Cas13a system and system and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 crRNA sequence design

[0073] Since the design of crRAN of CRISPR-Cas13a is different from the design of sgRNA of CRISPR-Cas9 system, there is no clear design principle of CRISPR-Cas13a crRNA. According to our previous work and experience, the design principles of crRNA targeting human RSPO2 gene are as follows: (1) crRNA includes spacer sequence and direct repeat sequence; (2) the length of crRNA spacer sequence is 22-28 base sequences; (3) the target point of crRNA spacer sequence on RSPO2 gene is located in the exon of the gene; (4) The PFS at the 3'end of the target sequence paired with the crRNA spacer sequence should not be G; (5) There is a seed region in the middle of the crRNA spacer sequence, and no mismatches can occur when combined with the target sequence (6) The direct repeat sequence of crRNA The length is greater than 24 base sequences; (7) The direct repeat sequence of crRNA should contain a stem loop structure. The crRNA in this example can b...

Embodiment 2

[0078] Example 2 crRNA sequence selection

[0079] Use Blast (www.ncbi.nlm.nig.gov / Blast) to perform homology analysis of candidate crRNA sequences and genome databases to ensure that the target sequence of the designed crRNA is unique and will not be homologous to other gene sequences other than the human RSPO2 gene . At the same time, the crRNA was screened according to the following principles to obtain the crRNA sequence for the efficient and specific detection of human RSPO2 gene: (1) The crRNA target cannot be too close to the start codon (ATG); (2) Off-Target rate low.

[0080] According to the above method, four crRNA spacer sequences targeting human RSPO2 gene were screened for different sites. The four target sequences are shown in SEQ ID NOs. 1, 5, 9, and 13 in the sequence table, and the crRNA spacer sequence corresponding to each target sequence is shown in SEQ ID NO. 2, 6, 10, and 14 in the sequence table. The target sequence, The crRNA spacer sequence and the cor...

Embodiment 3

[0081] Example 3 crRNA to synthesize DNA

[0082] For the convenience of storage and amplification in subsequent experiments, the present invention synthesizes crRNA into DNA and transcribes it into RNA in vitro during use: (1) According to the selected crRNA spacer sequence, add GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC to the 5` end (direct repeat corresponding to LwCas13a protein) Sequence) or CCACCCCAAUAUCGAAGGGGACUAAAAC (the direct repeat sequence corresponding to the LshCas13a protein) to obtain the crRNA sequence; (2) The crRNA sequence format is:

[0083] 5`-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-crRNA spacer sequence-3`; (LwCas13a)

[0084] or

[0085] 5`-CCACCCCAAUAUCGAAGGGGACUAAAAC-crRNA spacer sequence-3`; (LshCas13a)

[0086] (3) Add the T7 promoter sequence (TAATACGACTCACTATAGGG) in 5`, the DNA sequence format is as follows:

[0087] Forward sequence (LwCas13a):

[0088] 5`-TAATACGACTCACTATAGGG-GATTTAGACTACCCCAAAAACGAA GGGGACTAAAAC-crRNA DNA sequence corresponding to the spacer ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses crRNA specifically targeting toward a human RSPO2 gene in a CRISPR-Cas13a system and a system and an application. The crRNA can establish a CRISPR-Cas13a system for specific targeting toward a human RSPO2 gene. A trace of a RSPO2 gene is specifically detected in a body fluid. The system is non-invasive, can perform frequent detection, and is fast in detection speed. Compared with liquid biopsy in the prior art, the system can detect a trace of a RSPO2 gene in the body liquid via fluorescent reading. The system doesn't require high-flux sequencing, is low in cost, high in detection speed, and suitable for clinic large-scale application.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a crRNA that specifically targets the human RSPO2 gene by the CRISPR-Cas13a system in body fluids, and the system and application thereof. Background technique [0002] Liver fibrosis is the wound healing response of the liver to chronic liver injury caused by various reasons, which leads to the proliferation and precipitation of a large number of fibrous tissues in the liver lobules and the portal area. The pathological feature is the synthesis of various components of the extracellular matrix mainly composed of collagen Increased, relatively insufficient degradation, but did not form the intralobular septum, if it develops further, it will enter liver cirrhosis. Liver fibrosis is a reversible process. Prevention and early intervention of liver fibrosis are the best measures to stabilize the condition and prevent the development of liver fibrosis to cirrhosis and liver cancer....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90C12N9/22C12Q1/6888C12Q1/6811
CPCC12N9/22C12N15/113C12N15/90C12Q1/6811C12Q1/6888C12N2310/14C12N2310/12C12N2310/531C12Q2600/178C12Q2521/301C12Q2525/301C12Q2522/101C12Q2525/151C12Q1/6883C12Q2600/158C12N2310/20C12N15/11C12N2800/80C12Q1/6848
Inventor 虞玲华姚明
Owner JIAXING NO 1 HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com