Method for promoting oleaginous yeasts for produce oil
A technology of oleaginous yeast and Liposaccharomyces, which is applied in the field of phosphate acetyltransferase PTA, and can solve problems such as lack of PTA gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: PTA expresses the construction of recombinant Rhodosporidium toruloides strain Rtcg-PTA
[0034] The oleaginous yeast Rhodosporidium toruloides CGMCC 2.1389 was purchased from China General Microorganism Culture Collection and Management Center. Design the following primers according to the nucleotide sequence of PTA, be used to construct the vector that PTA expresses in R.toruloides (the underline part that has EcoR V in the primer name is the EcoR V restriction site, has Spe I in the primer name The underlined part is the Spe I restriction site, and the italic part is His-Tag):
[0035] PTA-EcoV-F: CCATGG GATATC ATGCACCACCACCACCACCACCACGCTGACCCTCTTCTCGAC
[0036] PTA-spe I-R: GG ACTAGT CTAGAGAGCCTGAGCCGCC
[0037] According to the nucleotide sequence of GPD-p, the following primers were designed to construct the constitutive cloning vector pZPK (the underlined part of the primer Pgpd-Xbal I-F is the XbaI restriction site, and the underlined part of...
Embodiment 2
[0054] Embodiment 2: PTA expresses the construction of recombinant Rhodosporidium toruloides strain Rtat-PTA
[0055] The oleaginous yeast Rhodosporidium toruloides ATCC 10788 was purchased from the American Type Culture Collection. Primers were designed according to the nucleotide sequence of PTA. PTA-EcoV-F and PTA-spe I-R were used to construct the vector pZPK-GPD-PTA expressing PTA in R. toruloides. The specific process was the same as in Example 1. Then, the PTA gene was transformed into R. toruloides by electroporation, and screened on the YEPD plate containing hygromycin. The transformants were picked and fermented in 30g / L acetic acid-limited nitrogen to produce oil. The corresponding engineering strain of Rhodosporidium toruloides was named Rtat-PTA. Compared with the control strain ATCC 10788, the intracellular lipid content of recombinant Rhodosporidium toruloides Rtat-PTA increased from 24% to 35%, and the biomass increased from 1.5g / L to 7.5g / L. This proves tha...
Embodiment 3
[0071] Embodiment 3: the construction of PTA recombinant Rhodotorula sticky
[0072] Rhodotorula glutinis CGMCC 2.703 was purchased from China General Microorganism Culture Collection and Management Center. Rhodotorula viscosus was transformed with AGL-GPD-PTA, and the PTA gene was introduced into Rhodotorula viscosus. The specific process was the same as in Example 1. After screening on a hygromycin resistance plate, the Rhodotorula viscosus engineering strain Rg-PTA was finally obtained.
[0073] The recombinant Rhodotorula viscosus engineering strain Rg-PTA and the starting strain were inoculated in YEPD medium, 28°C, 200rpm, cultured for 24h, and then transferred to 50mL 70g / L xylose-limited nitrogen with 10% inoculum Medium, 30°C, 200rpm. The results showed that, compared with the control strain R.glutinis, the engineered strain Rg-PTA of Rhodotorula glutinis consumed all xylose in 8 days, while the control strain R.glutinis needed 10.5 days to consume all xylose. And t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



