Method for promoting oleaginous yeasts for produce oil

A technology of oleaginous yeast and Liposaccharomyces, which is applied in the field of phosphate acetyltransferase PTA, and can solve problems such as lack of PTA gene

Inactive Publication Date: 2018-06-29
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, so far no one has overexpressed the PTA gene in oleaginous yeast, nor has anyone used this gene for oil production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting oleaginous yeasts for produce oil
  • Method for promoting oleaginous yeasts for produce oil
  • Method for promoting oleaginous yeasts for produce oil

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: PTA expresses the construction of recombinant Rhodosporidium toruloides strain Rtcg-PTA

[0034] The oleaginous yeast Rhodosporidium toruloides CGMCC 2.1389 was purchased from China General Microorganism Culture Collection and Management Center. Design the following primers according to the nucleotide sequence of PTA, be used to construct the vector that PTA expresses in R.toruloides (the underline part that has EcoR V in the primer name is the EcoR V restriction site, has Spe I in the primer name The underlined part is the Spe I restriction site, and the italic part is His-Tag):

[0035] PTA-EcoV-F: CCATGG GATATC ATGCACCACCACCACCACCACCACGCTGACCCTCTTCTCGAC

[0036] PTA-spe I-R: GG ACTAGT CTAGAGAGCCTGAGCCGCC

[0037] According to the nucleotide sequence of GPD-p, the following primers were designed to construct the constitutive cloning vector pZPK (the underlined part of the primer Pgpd-Xbal I-F is the XbaI restriction site, and the underlined part of...

Embodiment 2

[0054] Embodiment 2: PTA expresses the construction of recombinant Rhodosporidium toruloides strain Rtat-PTA

[0055] The oleaginous yeast Rhodosporidium toruloides ATCC 10788 was purchased from the American Type Culture Collection. Primers were designed according to the nucleotide sequence of PTA. PTA-EcoV-F and PTA-spe I-R were used to construct the vector pZPK-GPD-PTA expressing PTA in R. toruloides. The specific process was the same as in Example 1. Then, the PTA gene was transformed into R. toruloides by electroporation, and screened on the YEPD plate containing hygromycin. The transformants were picked and fermented in 30g / L acetic acid-limited nitrogen to produce oil. The corresponding engineering strain of Rhodosporidium toruloides was named Rtat-PTA. Compared with the control strain ATCC 10788, the intracellular lipid content of recombinant Rhodosporidium toruloides Rtat-PTA increased from 24% to 35%, and the biomass increased from 1.5g / L to 7.5g / L. This proves tha...

Embodiment 3

[0071] Embodiment 3: the construction of PTA recombinant Rhodotorula sticky

[0072] Rhodotorula glutinis CGMCC 2.703 was purchased from China General Microorganism Culture Collection and Management Center. Rhodotorula viscosus was transformed with AGL-GPD-PTA, and the PTA gene was introduced into Rhodotorula viscosus. The specific process was the same as in Example 1. After screening on a hygromycin resistance plate, the Rhodotorula viscosus engineering strain Rg-PTA was finally obtained.

[0073] The recombinant Rhodotorula viscosus engineering strain Rg-PTA and the starting strain were inoculated in YEPD medium, 28°C, 200rpm, cultured for 24h, and then transferred to 50mL 70g / L xylose-limited nitrogen with 10% inoculum Medium, 30°C, 200rpm. The results showed that, compared with the control strain R.glutinis, the engineered strain Rg-PTA of Rhodotorula glutinis consumed all xylose in 8 days, while the control strain R.glutinis needed 10.5 days to consume all xylose. And t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing the efficient production of microbial oil strains by utilizing metabolic engineering strategies and application thereof. The invention relates to overexpression of acetyltransferase phosphate in oleaginous yeasts. The method can enhance the supply of oil synthesis precursor acetyl coenzymes A, improve the oil yield and effectively improve the economy of microbial oil.

Description

technical field [0001] The present invention relates to phosphate acetyltransferase PTA, specifically based on the Bacillus subtilis PTA protein sequence, according to the recombinant vector construction of the phosphate acetyltransferase PTA synthesized by the whole gene after the codon preference optimization of Rhodosporidium toruloides, and Applications in metabolic engineering research. Background technique [0002] Oil is a kind of natural renewable resource with low oxygen content, high energy density, and rich in hydrocarbon elements. It is the basic raw material for the production of liquid biofuels, oleochemicals, food and materials, and is widely used in daily production and all aspects of life. [Jin MJ et al. Trends Biotechnol, 2015, 33:43-54.]. The production of traditional animal and vegetable oils is limited, it is difficult to meet the growing demand, and there are problems of competing with people for food and land with farmers. Microorganisms have the char...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/54C12P7/64
CPCC12N9/1029C12N15/815C12N2800/22C12P7/6463Y02E50/10
Inventor赵宗保杨晓兵张素芳
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI