Application of heat shock protein groel in preparation of reagents for detection of Helicobacter pylori

A technology of Helicobacter pylori and heat shock protein, which is applied in the application field of reagents, can solve problems such as incompleteness, and achieve the effect of increased detection rate and good specificity

Active Publication Date: 2020-03-24
SHENZHEN BLOT BIOTECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has also been found clinically that many non-virulent H.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of heat shock protein groel in preparation of reagents for detection of Helicobacter pylori
  • Application of heat shock protein groel in preparation of reagents for detection of Helicobacter pylori
  • Application of heat shock protein groel in preparation of reagents for detection of Helicobacter pylori

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The preparation of embodiment 1 recombinant groEL protein

[0037] 1. Acquisition of groEL target gene:

[0038] 1. Design of groEL primers:

[0039] groEL-F: cgcgctcgagggcaaaagaaatcaaat

[0040] groEL-R:tctggtacccatcatgccacccatggc

[0041] 2. Using the strain NCTC 11637 as a template to amplify the groEL target gene:

[0042] The PCR reaction system is as follows:

[0043]

[0044]

[0045] PCR reaction parameters:

[0046]

[0047] The PCR electrophoresis product picture is as follows figure 1 .

[0048] Analysis of the results: a single band was amplified from the groEL target gene, the size of which was between 1500bp and 2000bp, which was in line with the size of the target gene groEL 1638bp.

[0049] 2. Double digestion, ligation and transformation of target gene groEL and vector pTrchis2C

[0050] 1. Double digestion of target gene groEL and vector pTrchis2C

[0051] Use XhoI and KpnI to double-digest the plasmid vector pTrchis2C and the target ...

Embodiment 2

[0067] The preparation of embodiment 2 enzyme plate

[0068] 1. Dilute the recombinant groEL protein to 1 μg / ml as a coating solution, 100 μL / well, put it in an aluminum foil bag at 4°C overnight for coating (37°C for 2 hours has the same effect).

[0069] 2. Shake off the coating solution and pat dry.

[0070] 3. Wash three times with washing solution, soak for 1min each time, 300μL / well, shake off the washing solution, and pat dry.

[0071] 4. Blocking: block with 200 μl / well of blocking solution, block at 37°C for 1 hour, shake off the blocking solution, pat dry, and wash three times with the same method as above.

[0072] 5. Dry at 37°C for 1-2 hours.

[0073] 6. Put the dried ELISA plate and desiccant into an aluminum foil bag and seal it at 4°C for later use.

Embodiment 3E

[0074] Embodiment 3ELISA detects Helicobacter pylori

[0075] 1. Samples to be tested:

[0076] Sample 1: Dilute the negative serum confirmed to contain no groEL antibody 100 times with the sample diluent, and add Escherichia coli, denatured bacteria, Campylobacter jejuni, Bacillus subtilis, Enterococcus faecium, and Pseudomonas albicans to the diluted negative serum. silk yeast.

[0077] Sample 2: The 8 strong positive sera confirmed to contain groEL antibodies were diluted 100 times with the sample diluent, and the diluted strong positive sera were added with Helicobacter pylori standard strain 11637, Escherichia coli, denatured bacteria, Campylobacter jejuni, Bacillus subtilis, Enterococcus faecium, Candida albicans.

[0078] Measure the OD of the cultured bacterial solution 600 , use 1ml 100-fold diluted serum to make the OD of the bacterial solution 600 When adjusted to 0.2 (OD600=0.1, the CFU per milliliter of bacterial solution is 1*10 7 ), the calculation method i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technological field of biotechnology, and especially relates to an application of a heat shock protein groEL to preparation of a reagent for detecting Helicobacter pylori.The application of the heat shock protein groEL to a marker for detecting Helicobacter pylori is provided; experiments confirm that heat shock protein groEL is used as the marker for detecting Helicobacter pylori, detection rate of Helicobacter pylori virulence type is greatly improved, the accuracy rate reaches 98% or above, the maker is not interfered by non-virulence type helicobacter pylori or other pathogens, and the maker has good specificity.

Description

technical field [0001] The invention relates to the technical field of biotechnology, in particular to the application of heat shock protein groEL in the preparation of reagents for detecting Helicobacter pylori. Background technique [0002] Heat shock proteins are stress proteins that are ubiquitous in bacteria and mammals. It has been reported that the heat shock protein of Helicobacter pylori may act as an initiation factor for the development and persistence of gastric mucosal chronic diseases. [0003] Helicobacter pylori antibody typing is currently a commonly used typing method. Its value in evaluating the virulence of Helicobacter pylori and guiding clinical treatment has been widely recognized, and it can serve the precise treatment of Helicobacter pylori-related diseases more scientifically and effectively. The existing Helicobacter pylori typing method mainly judges the virulence level of the infected Helicobacter pylori by the presence or absence of CagA (cytot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/68G01N33/569
CPCG01N33/56911G01N33/68
Inventor刘谦王洪涛马伟民张永顶
OwnerSHENZHEN BLOT BIOTECH