A ring-shaped dumbbell-shaped probe and its application
A dumbbell-shaped, probe technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of reduced cell activity, limited accuracy, slow reaction rate, etc., to achieve high sensitivity, good accuracy, The effect of less time required for amplification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1 A circular dumbbell-shaped probe for detecting target sequences
[0084] This embodiment takes the detection of miR-27a: 5'-UUC ACA GUG GCU AAG UUC CGC-3' (SEQ ID NO: 9) in the miR-27 family as an example.
[0085] According to the target sequence miR-27a, two different circular dumbbell-shaped probes were designed, which were respectively denoted as H1 (SEQ ID NO: 1) and H2 (SEQ ID NO: 3). Both H1 and H2 were closed base sequences, Both are dumbbell-shaped, and the rings at both ends are connected together by the neck in the middle, and the neck is composed of reverse complementary paired base pairs;
[0086] H1 contains a fragment X that is reverse-complementary to the target sequence miR-27a. Part of the base sequence (7bp) in X is located at the loop. This part of the sequence is called the toehold sequence, and the remaining sequence (14bp) in X is located at the neck ;
[0087] H2 contains a fragment Y that can perform reverse complementary pairing wit...
Embodiment 2
[0102] Synthesis and detection of embodiment 2 circular dumbbell-shaped probe
[0103] 2.1 Synthesis of circular dumbbell-shaped probes
[0104] Design a series of different types of dumbbell-shaped probes (SEQ ID NO: 1-8), and commission Shanghai BioSynthesis to synthesize them. The 5' end of the probes is modified with a phosphate group, connected by T4DNA ligase and extra-nucleic acid After processing the synthesized probe with Dicer I and Exonuclease III, a purified circular dumbbell-shaped DNA probe can be obtained, and the specific operations are as follows:
[0105] The commissioned probe was denatured at 95°C for 5 minutes, and naturally cooled to room temperature to make the probe an open ring. Take 30 μL of the probe solution, add 5 μL of 10×T4 DNA ligase buffer and 2 μL of T4 DNA ligase (100 U / μL) at 16 °C, react for 2 h, and denature at 65 °C for 10 min to terminate the ligation reaction. Then add exonuclease I (20U / μL) and exonuclease III (100U / μL) to the soluti...
Embodiment 3
[0108] Embodiment 3 Determination of hydrolysis resistance of ring-shaped dumbbell-shaped probe
[0109] In order to verify the hydrolysis resistance of circular probes, firstly design linear probes L and P containing FAM-BHQ1 labels according to the target sequence miR-27a (L and P are completely complementary, mix L and P in equal proportions to form LP probes) , hairpin probe HP and circular dumbbell-shaped probe CP (H1.2) of the present invention, miR-27a antisense probe block probe. The sequences of each probe are as follows:
[0110] L: 5'-TTCACAGTGGCTAAGTTCCGC(BHQ1)-3' (SEQ ID NO: 10);
[0111] P: 5-(FAM)GCGGAACTTAGCCACTGTGAA-3 (SEQ ID NO: 11);
[0112] HP: 5-(FAM)CGCGCGGAACTTAGCCACTGTGAACGCGCG(BHQ1)-3 (SEQ ID NO: 12);
[0113] Block probe: 5-GCGGAACTTAGCCACTGTGAA-3 (SEQ ID NO: 13);
[0114] CP(H1.2):
[0115] 3-T(FAM)GAATCGGTAAAAGTGTCACCGATT(BHQ1)CAAGGCGCCCACACACCGCCT-5 (SEQ ID NO: 2).
[0116] 3.1 Detection of probe hydrolysis resistance
[0117] The linear pro...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com