A ring-shaped dumbbell-shaped probe and its application

A dumbbell-shaped, probe technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of reduced cell activity, limited accuracy, slow reaction rate, etc., to achieve high sensitivity, good accuracy, The effect of less time required for amplification

Active Publication Date: 2021-06-01
SUN YAT SEN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the HCR reaction has been widely used for the detection of intracellular nucleic acids, but the two defects of false positives and high background when this method is applied to in situ imaging studies of nucleic acids in living cells greatly limit the accuracy of this method
(1) Traditional HCR reactions mainly use linear probes or hairpin probes as reactants. After these probes enter living cells, their 3' and 5' ends are easily recognized by hydrolytic enzymes in living cells after a period of time. Causes the probe to be hydrolyzed causing false positives
(2) The traditional HCR reaction, especially the reaction based on the hairpin probe, has a slow reaction rate and generally needs to be reacted for 4 hours to complete. Longer reaction time will lead to high background and low signal-to-noise ratio due to probe hydrolysis. May cause decreased cell viability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A ring-shaped dumbbell-shaped probe and its application
  • A ring-shaped dumbbell-shaped probe and its application
  • A ring-shaped dumbbell-shaped probe and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 A circular dumbbell-shaped probe for detecting target sequences

[0084] This embodiment takes the detection of miR-27a: 5'-UUC ACA GUG GCU AAG UUC CGC-3' (SEQ ID NO: 9) in the miR-27 family as an example.

[0085] According to the target sequence miR-27a, two different circular dumbbell-shaped probes were designed, which were respectively denoted as H1 (SEQ ID NO: 1) and H2 (SEQ ID NO: 3). Both H1 and H2 were closed base sequences, Both are dumbbell-shaped, and the rings at both ends are connected together by the neck in the middle, and the neck is composed of reverse complementary paired base pairs;

[0086] H1 contains a fragment X that is reverse-complementary to the target sequence miR-27a. Part of the base sequence (7bp) in X is located at the loop. This part of the sequence is called the toehold sequence, and the remaining sequence (14bp) in X is located at the neck ;

[0087] H2 contains a fragment Y that can perform reverse complementary pairing wit...

Embodiment 2

[0102] Synthesis and detection of embodiment 2 circular dumbbell-shaped probe

[0103] 2.1 Synthesis of circular dumbbell-shaped probes

[0104] Design a series of different types of dumbbell-shaped probes (SEQ ID NO: 1-8), and commission Shanghai BioSynthesis to synthesize them. The 5' end of the probes is modified with a phosphate group, connected by T4DNA ligase and extra-nucleic acid After processing the synthesized probe with Dicer I and Exonuclease III, a purified circular dumbbell-shaped DNA probe can be obtained, and the specific operations are as follows:

[0105] The commissioned probe was denatured at 95°C for 5 minutes, and naturally cooled to room temperature to make the probe an open ring. Take 30 μL of the probe solution, add 5 μL of 10×T4 DNA ligase buffer and 2 μL of T4 DNA ligase (100 U / μL) at 16 °C, react for 2 h, and denature at 65 °C for 10 min to terminate the ligation reaction. Then add exonuclease I (20U / μL) and exonuclease III (100U / μL) to the soluti...

Embodiment 3

[0108] Embodiment 3 Determination of hydrolysis resistance of ring-shaped dumbbell-shaped probe

[0109] In order to verify the hydrolysis resistance of circular probes, firstly design linear probes L and P containing FAM-BHQ1 labels according to the target sequence miR-27a (L and P are completely complementary, mix L and P in equal proportions to form LP probes) , hairpin probe HP and circular dumbbell-shaped probe CP (H1.2) of the present invention, miR-27a antisense probe block probe. The sequences of each probe are as follows:

[0110] L: 5'-TTCACAGTGGCTAAGTTCCGC(BHQ1)-3' (SEQ ID NO: 10);

[0111] P: 5-(FAM)GCGGAACTTAGCCACTGTGAA-3 (SEQ ID NO: 11);

[0112] HP: 5-(FAM)CGCGCGGAACTTAGCCACTGTGAACGCGCG(BHQ1)-3 (SEQ ID NO: 12);

[0113] Block probe: 5-GCGGAACTTAGCCACTGTGAA-3 (SEQ ID NO: 13);

[0114] CP(H1.2):

[0115] 3-T(FAM)GAATCGGTAAAAGTGTCACCGATT(BHQ1)CAAGGCGCCCACACACCGCCT-5 (SEQ ID NO: 2).

[0116] 3.1 Detection of probe hydrolysis resistance

[0117] The linear pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a ring-shaped dumbbell-shaped probe and its application. The invention designs two ring-shaped dumbbell-shaped probes, and then uses the probes to carry out chain hybridization reaction amplification to detect the concentration of the target to be tested and apply it to In situ imaging of intracellular target sequences. Compared with the existing strand hybridization amplification method, this method overcomes the defect that linear probes or hairpin probes are easily hydrolyzed in cells, and finds that circular nucleic acid probes have strong hydrolysis resistance, and combines circular probes with strand hybridization reactions Used for target sequence imaging in live cells reduces false positives and background signals and improves detection accuracy.

Description

technical field [0001] The invention belongs to the technical field of molecular detection, and in particular relates to a circular dumbbell-shaped probe and an application thereof. Background technique [0002] MiRNA is a class of non-coding small molecule RNA (18-24 bases) that regulates gene expression. It plays an important role in the growth, development, differentiation and reproduction of animals and plants. About 30% of human genes are regulated by miRNA, and the expression level of miRNA is closely related to major human diseases. Quantitative detection of miRNA is helpful for in-depth understanding of its mechanism of action, which is of great significance to the diagnosis and treatment of diseases and the development of related gene medicines. Due to the short sequence of miRNA, the expression level in cells or body fluids is very low, easy to degrade, and the difference between homologous miRNAs is only 1-2 bases, it is difficult to detect by general methods; ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6876C12Q1/6841
CPCC12Q1/6841C12Q1/6876C12Q2600/178C12Q2563/107
Inventor戴宗陈俊邹小勇
OwnerSUN YAT SEN UNIV