Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting NOD1 gene single nucleotide polymorphism with HRM (High Resolution Melting) technology

A single nucleotide polymorphism and technology detection technology, applied in the field of HRM technology detection of NOD1 gene single nucleotide polymorphism, can solve the problems of high reaction conditions, complicated operation process, cumbersome test process, etc., and achieve high sensitivity And the effect of high specificity, good repeatability, and shortened detection time

Inactive Publication Date: 2018-07-31
济南艾迪康医学检验中心有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RFLP does not require high equipment, but the operation process is complicated, and false negative errors are prone to occur; AS-PCR has high requirements on primer design and PCR reaction conditions, and false positive errors are prone to occur; Sanger sequencing method has accurate results, but the test process is cumbersome. higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting NOD1 gene single nucleotide polymorphism with HRM (High Resolution Melting) technology
  • Method for detecting NOD1 gene single nucleotide polymorphism with HRM (High Resolution Melting) technology
  • Method for detecting NOD1 gene single nucleotide polymorphism with HRM (High Resolution Melting) technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The method for detecting the SNP site rs2075820 of the NOD1 gene in the subject by using the high-resolution melting curve (HRM) method includes obtaining sample DNA and providing reagents required for sequencing. Refer to Example 2 for specific operation steps. The reagents include: Whole Blood Genomic DNA Extraction Kit (QIAGEN), HRM Detection Kit FP210 (Tiangen Biochemical Technology Co., Ltd., Beijing, China), primers for detecting rs2075820 site, standard products and negative control products. Among them, the primers for detecting the rs2075820 site are:

[0025] NOD1-F-HRM:GCTTCAAGGAAAGTGACAGGC;

[0026] NOD1-R-HRM: CAGGTCCAAGTCCGAGTGC.

[0027] Standards are GG genotype, GA genotype and AA genotype DNA samples; negative control: DNA-free solution.

[0028] Detection system PCR reaction solution includes:

[0029]

[0030] The PCR reaction procedure is:

[0031]

[0032] The present invention also adopts the sequencing method to further verify the resul...

Embodiment 2

[0042] Operation procedure of blood / cell / tissue genomic DNA extraction kit (QIAGEN):

[0043] (1) Genomic DNA extraction from whole blood

[0044] 1) Add 20μl QIAGEN Protease (or proteinase K) to the bottom of a 1.5ml centrifuge tube. .

[0045] 2) Add 200 μl of plasma to the centrifuge tube.

[0046] 3) Add 200 μl Buffer AL and shake for 15 seconds. (Note: Do not add QIAGEN Protease or proteinase K directly to Buffer AL. If the sample size is large, increase QIAGEN Protease and Buffer AL proportionally.)

[0047] 4) Water bath at 56°C for 10 minutes, and then briefly centrifuge to remove the liquid on the inner edge of the centrifuge tube cover.

[0048] 5) Add 200 μl of ethanol (96%-100%), shake for 15 s, and briefly centrifuge to remove the liquid along the inner edge of the centrifuge tube cover.

[0049] 6) Carefully add the mixture (including the precipitate) obtained above to the QIAamp Mini spin column (without wetting the rim). Put the spin column into a 2ml coll...

Embodiment 3

[0096] Embodiment 3 clinical sample detection

[0097] Forty clinical samples to be tested were taken, and the genome was extracted, reagents were prepared and tested according to the methods and reagents described in Examples 1 and 2.

[0098] Add 1 μL of each sample to the detection system PCR reaction solution. At the same time, make a copy of each standard product. Detect with a fluorescent PCR instrument, and the time is 120 minutes.

[0099] Such as figure 1 Shown are the HRM results for Standard AA, Standard GA, and Standard GG.

[0100] Such as figure 2 Shown are the HRM results of 40 clinical samples and standards.

[0101] According to the HRM results, the genotypes at the rs2075820 locus of the NOD1 gene of 40 screening samples were interpreted as shown in Table 1 below.

[0102] Table 1

[0103]

[0104]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to detection of a NOD1 gene single nucleotide polymorphism site rs2075820 in a patient suffering from a H.pylori infection-correlated disease, in particular to an amplification primer for detecting NOD1 gene single nucleotide polymorphism with a HRM detection technology and a detection method. The method has the advantages of easiness and convenience in operation, high detection speed, high flux, low cost, high sensitivity, high specificity, high repeatability and convenience in interpretation of results. The method facilitates the early detection, early diagnosis and early treatment of clinical H.pylori infection-correlated diseases, and has important significance to the immediate intervention and treatment for avoiding disease progression, adjustment of treatment scheme, prognostic prediction and prevention of clinical relapse.

Description

technical field [0001] This patent relates to a gene polymorphism detection method for clinical testing, which uses HRM technology to detect the SNP site rs2075820 of the NOD1 gene in patients with Hp infection, and at the same time conducts a more accurate screening of high-risk groups. The method can effectively save detection time and cost and improve detection accuracy. technical background [0002] Gastric cancer is one of the most common malignant tumors in the world, accounting for the fourth place in the incidence of various malignant tumors and the second place in the cause of death of malignant tumors after lung cancer. The World Health Organization (WHO) reported that there were 1.1 million new gastric cancer patients in the world in 2010, 60% of which occurred in developing countries. China is a country with a high incidence of gastric cancer, and the incidence and mortality of gastric cancer rank third among malignant tumors. Studies have found that the occurr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2531/113C12Q2527/107C12Q2545/113
Inventor 牛林梅林筱剑王淑一
Owner 济南艾迪康医学检验中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com