Primer set for rapidly detecting chronic obstructive pulmonary diseases, and preparation method thereof

A chronic obstructive pulmonary disease, primer set technology, applied in the direction of biochemical equipment and methods, recombinant DNA technology, microbial measurement/testing, etc., can solve problems such as errors, errors, and poor safety

Inactive Publication Date: 2018-09-28
SHANGHAI PASSION BIOTECHNOLOGY CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the past, PCR amplification technology and polyacrylamide gel electrophoresis were generally used for detection, but this electrophoresis method is very prone to errors and leads to wrong conclusions, and the safety is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer set for rapidly detecting chronic obstructive pulmonary diseases, and preparation method thereof
  • Primer set for rapidly detecting chronic obstructive pulmonary diseases, and preparation method thereof
  • Primer set for rapidly detecting chronic obstructive pulmonary diseases, and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] A primer set for rapid detection of chronic obstructive pulmonary disease, which uses the SSR site in the promoter sequence of HO-1 as the target sequence, and designs the following primers according to the conserved sequences on both sides of the SSR site:

[0039]

[0040]

[0041] The fragment repeat number n of the above primer set ranges from 15 to 40, where n<25 is an S-type site, 25≤n<30 is an M-type site, and n≥30 is an L-type site.

[0042] The preparation method of the above-mentioned primer set for rapid detection of chronic obstructive pulmonary disease, comprising the following steps:

[0043] (1) Extraction of genomic DNA (see Tiangen DP304-3 / blood tissue cell genome extraction kit for the operation steps)

[0044] (2) DNA quality detection

[0045] Determine the quality of DNA by measuring the absorbance of the sample at 260nm and 280nm (instrument Nanodrop2000 ultra-trace UV-visible spectrophotometer);

[0046] (3) PCR amplification of the target...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a primer set for rapidly detecting chronic obstructive pulmonary diseases, wherein the primers HO-1F: FAM-AGAGCCTGCAGCTTCTCAGA and HO-1R: ACAAAGTCTGGCCATAGGAC are designed by using the SSR locus in the promoter sequence of HO-1 as a target sequence according to the conserved sequences on both sides of the SSR locus. According to the present invention, the H0-1 is close to the anti-oxidation effect of the body, is mainly distributed in alveolar macrophages, and has anti-inflammatory and anti-oxidation effects, wherein the expression of the H0-1 can be induced bysmoking, hypoxia and hyperoxia; the HO-1 gene is located on human chromosome 22 (22q12), wherein the gene promoter region GT repeat polymorphism acts by affecting the expression of the HO-1; and the L-type allele of the HO-1 gene promoter region (GT repetitive sequence, n is more than 30) can reduce the expression of the HO-1 in smoking patients, such that the anti-oxidation capacity of the body is weakened so as to promote the occurrence of COPD.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a primer set for rapid detection of chronic obstructive pulmonary disease and a preparation method thereof. Background technique [0002] Chronic obstructive pulmonary disease (COPD) is a disease characterized by airflow limitation that is not fully reversible, usually progressive and accompanied by an abnormal inflammatory response to toxic particles or gases. COPD includes chronic bronchitis (CB) with small airway obstruction and chronic pulmonary emphysema (CPE) with enlarged air spaces, destruction of lung parenchyma, loss of lung tissue elasticity, and small airway occlusion. Irreversible airflow limitation is an important feature of COPD. With the aging of the world's population, the increasing number of smokers and the increasing air pollution, the incidence and mortality of COPD are also increasing. At the same time, it can also cause other diseases, such as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 陈升朱月艳孙子奎
Owner SHANGHAI PASSION BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap