36 results about "Hyperoxia" patented technology

The present invention relates to Pyridyl-Substituted Porphyrin Compounds, compositions comprising an effective amount of a Pyridyl-Substituted Porphyrin Compound and methods for treating or preventing injury due to exposure to a reactive species, erectile dysfunction due to surgery, lung disease, hyperoxia, neurodegenerative disease, liver disease, myocardial damage during cardioplegia, an inflammatory condition, a reperfusion injury, an ischemic condition, a cardiovascular disease, diabetes, a diabetic complication, cancer, a side effect of cancer chemotherapy, or a radiation-induced injury, or to prolong the half-life of an oxidation-prone compound, comprising administering to a subject in need thereof an effective amount of a Pyridyl-Substituted Porphyrin Compound.

Physiologic sensors and methods of application are described. These sensors function by detecting recently discovered variations in the spectral optical density at two or more wavelengths of light diffused through the skin. These variations in spectral optical density have been found to consistently and uniquely relate to changes in the availability of oxygen in the skin tissue, relative to the skin tissue's current need for oxygen, which we have termed Physiology Index (PI). Current use of blood gas analysis and pulse oximetry provides physiologic insight only to blood oxygen content and cannot detect the status of energy conversion metabolism at the tissue level. By contrast, the PI signal uniquely portrays when the skin tissue is receiving ‘less than enough oxygen,’‘just the right amount of oxygen,’ or ‘more than enough oxygen’ to enable aerobic energy conversion metabolism. The PI sensor detects one pattern of photonic response to insufficient skin tissue oxygen, or tissue hypoxia, (producing negative PI values) and a directly opposite photonic response to excess tissue oxygen, or tissue hyperoxia, (producing positive PI values), with a neutral zone in between (centered at PI zero). Additionally, unique patterns of PI signal response have been observed relative to the level of physical exertion, typically with a secondary positive-going response trend in the PI values that appears to correspond with increasing fatigue. The PI sensor illuminates the skin with alternating pulses of selected wavelengths of red and infrared LED light, then detects the respective amount of light that has diffused through the skin to an aperture located a lateral distance from the light source aperture. Additional structural features include means of internally excluding light from directly traveling from the light emitters to the photodetector within the sensor. This physiology sensor and methods of use offer continuous, previously unavailable information relating to tissue-level energy conversion metabolism. Several alternative embodiments are described, including those that would be useful in medical care, athletics, and personal health maintenance applications.

A controlled enhanced-oxygen (hyperoxic) breathing system involving an oxygen source, a control valve system and a breathing interface, is disclosed. The control valve system may include a demand flow valve and a venturi valve arranged to introduce ambient air into an oxygen stream to provide a desired level of oxygen in the resultant hyperoxic air stream. Alternatively, the control valve system may include a nitrogen-removal unit, such as nitrogen scrubber, to increase the oxygen content above that of ambient air. The control valve system may further include a one-way flow valve and may further be joined to a plenum for storing hyperoxic air. The hyperoxic breathing system is typically connected to a breathing mask for use by an individual undergoing exercise or physical training activities.

The invention discloses a method for preparing multi-nuclear-shell hollow nickel-nickel silicate-CeO2 through methane reforming. The method includes the steps of (1) preparing silicon dioxide nanoparticles; (2) adding nickel precursors into the silicon dioxide nanoparticles, and preparing hollow nickel silicate spheres at the temperature of 50-220oC; (3) dispersing the hollow nickel silicate spheres into mixed liquor of ethyl alcohol and water, adding CeO2 precursors and precipitators, and performing reaction at the temperature of 40-150oC to obtain nickel silicate-CeO2 nuclear shell hollow nanospheres; (4) reducing the nickel silicate-CeO2 nuclear shell hollow nanospheres to obtain the high-dispersion nickel-nickel silicate-CeO2 multi-nuclear-shell hollow catalyst. The prepared multi-nuclear-shell hollow nickel-nickel silicate-CeO2 catalyst has the advantages of high sintering resistance on nickel and CeO2, hyperoxia hole concentration, high carbon deposition resistance, high nickel dispersity, high CeO2 dispersity and the like, and displays high catalytic activity and carbon deposition resistance when being applied to catalytic reaction based on low-temperature methane reforming.

The invention discloses application of oridonin powder aerosol in treatment of acute lung injury. The oridonin powder aerosol is prepared by an oridonin nano-drug delivery system, wherein the dosage form of the nano-drug delivery system is selected from lipidosome, nanoparticles, nanosuspension, nanoemulsion and micro-emulsion. The medicines in the oridonin powder aerosol are stable, easily enter the deep parts of lung tissues, are positioned in a targeted mode and are convenient to carry and use, and the treatment of acute lung injury is promoted. The oridonin powder aerosol is used for treating the acute lung injury caused by infection, shock, smoking, trauma, toxin poisoning, inhalation of irritant gases, radiation, high oxygen and low oxygen, wherein the inhaled irritant gases comprise phosgene, diphosgene, triphosgene, chlorine, nitric oxides, formaldehyde, dimethyl sulfate, hydrogen chloride, hydrogen bromide, hydrogen fluoride, ammonia, ozone and sulfur dioxide.

The high oxygen and ozone ultrasonically atomizing method is that O2 in 99 % over concentration and atomized water particle are formed high O2 mist acting directly onto skin or O2, O3 the ozone generator produces and atomized water particle are sprayed to skin or ultrasonically introduced to skin, so as to reach the comprehensive beautifying and health care effects. The present invention has the functions of cleaning skin, killing bacteria in skin and pores, expanding local blood vessels to improve micro circulation, increasing local and systematic oxygen supply, strengthening cell immunity to delay senility, eliminating free radical, promoting metabolism, etc.

The invention provides a high-oxygen drinking water production process based on a gas nanocrystallization technology. The process comprises the following steps: water source water is filtered by a quartz sand filter and an activated carbon filter in sequence and then enters a water cooling device, and cooling water is further filtered by a precision filter and an ultrafilter in sequence after thewater pressure of the cooling water is increased by a raw water booster pump, is stored in a purified water tank, enters a degassing device for degassing after being sterilized by an environment-friendly sterilization device, and is stored in a nitrogen-sealed water tank; medical-grade oxygen is fed into an oxygen tank through an oxygen booster pump; water and oxygen are mixed in a gas-liquid mixing pump and then enter a spiral cutter to be subjected to gas-liquid cutting to form first-stage high-oxygen water, and then the first-stage high-oxygen water enters a sawtooth ejector to form high-concentration high-oxygen water; and the high-concentration high-oxygen water enters a security filter to remove foreign matters, then flows into the water tank of a filling machine, and is filled intoa container through an all-in-one machine to prepare high-oxygen drinking water. According to the invention, continuous production can be realized, and the produced high-oxygen water-soluble oxygen isstable and retains mineral elements and trace elements necessary for human metabolism.

The present invention relates to a system and method for providing power of maximum relevant specific energy. The system is more particularly defined as an operator-portable power supply utilizing a fuel containing hydrogen peroxide for energy, coupled with water and oxygen recovery, storage and delivery means. Extracting energy, water, and oxygen from the hydrogen peroxide fuel and refining to consumable forms (electrical, pneumatic, hydraulic, etc. energy; potable water; breathable oxygen) is for the purpose of increasing the overall energy output of the power supply per carried mass. The resultant water displaces water otherwise requiring transportation by the operator and the oxygen allows for hyperoxic respiration, increasing the metabolic power output of the operator.

Oxygen toxicity is one of the major risk factors in the development of the chronic lung disease or bronchopulmonary dysplasia in premature infants. Using proteomic analysis, we discovered mitochondrial aldehyde dehydrogenase (mtALDH or ALDH2) was down-regulated in neonatal rat lung after hyperoxic exposure. To study the role of mtALDH in hyperoxic lung injury, we overexpressed mtALDH in human lung epithelial cells (A549) and found that mtALDH significantly reduced hyperoxia-induced cell death. Compared to control cells (Neo-A549), the necrotic cell death in mtALDH overexpressing cells (mtALDH-A549) decreased from 25.3% to 6.5%, 50.5% to 9.1% and 52.4% to 15.06% after 24-, 48- and 72-hour hyperoxic exposure, respectively. The levels of intracellular and mitochondria-derived reactive oxygen species (ROS) in mtALDH-A549 cells after hyperoxic exposure were significantly lowered compared to Neo-A549 cells. mtALDH overexpression significantly stimulated extracellular signal regulated kinase (ERK) phosphorylation under normoxic and hyperoxic conditions. Inhibition of ERK phosphorylation partially eliminated the protective effect of mtALDH in hyperoxia-induced cell death, suggesting ERK activation by mtALDH conferred cellular resistance to hyperoxia. mtALDH overexpression augmented Akt phosphorylation and maintained the total Akt level in mtALDH-A549 cells under normoxic and hyperoxic conditions. Inhibition of PI3K activation by LY294002 in mtALDH-A549 cells significantly increased necrotic cell death after hyperoxic exposure, indicating that PI3K / Akt activation by mtALDH played an important role in cell survival after hyperoxia. Taken together, these data demonstrate that mtALDH overexpression attenuates hyperoxia-induced cell death in lung epithelial cells through reduction of ROS, activation of ERK / MAPK and PI3K / Akt cell survival signaling pathways.

A method of using pure oxygen in microbial fermentation processes and wastewater treatment processes, in which the pure oxygen is produced by a pressure swing adsorption (PSA) process from a gas mixture of air and unused oxygen-containing recycled off-gas from microbial processes which uses oxygen-containing gas in a liquid or gas state. When pure oxygen with a purity of more than 90% is used in microbial processes, microbial productivity can be about 5 times as increased as it is that in the conventional method using air with an oxygen content of 21%, and the volume of an active sludge tank in wastewater treatment processes can be reduced to at most ⅕ of the volume as compared to the conventional method. Also, the off-gas from such pure oxygen processes has a high oxygen content of about 70-80%. Thus, when the off-gas is recycled with air for the supplement of oxygen consumption, the gas mixture with an oxygen content of about 40% is used as feed gas for the PSA process, and CO2 generated by microbial breathing is also removed. Thus, the volume of a PSA column and an air compressor for supplying the feed gas can be reduced to less than ½ of the volume as compared to that of the use of air.

A method for precision cancer treatment by identifying drug resistance is provided. In some embodiments, the method may include: detecting tumor oxygenated perfusion by having a patient breathe air to acquire MRI baseline data; inhalation of hyperoxia gas to generate higher than baseline HbO2 blood circulating in body to acquire MRI enhanced data; the region-of-interest (ROI), which in this case is a tumor volume (V0), and which may be performed by volume contour tracing / region-of-interest (ROI) analysis and 3D tumor volumetry methods; calculating voxel's enhanced signal intensity (ΔSI); calculating tumor oxygenated perfusion percentage (OPP %); selecting different threshold and calculating maps such as a reconstruction OPP % pseudo color map; calculating tumor volume change ratio (Vt %); overlaying reconstruction OPP % pseudo color map to original images for visualizing tumor response data; drawing or plotting the OPP % and Vt % on a cancer treatment response information diagram, and identifying the type of drug resistance, classifying the drug resistance being caused by poor drug distribution factor or cells-specific factor based on pooled collected data.

Methods of treating or preventing allergic or pulmonary diseases characterized by endothelial dysfunction with Alda-1 are presented. Treatment of pulmonary endothelial cells subjected to hyperoxia with Alda-1 showed an increase in ALDH2 activity and expression. Treatment with Alda-1 also illustrated a decrease in oxidative stress, a decrease in reactive oxygen species (ROS), a decrease in apoptosis, a decrease in inflammation and an enhancement of mitochondrial membrane potential.

A method for treating, preventing, or ameliorating cardiovascular disease in a subject involves exposing the subject for an effective duration to a condition of hypobaric normoxia or hypobaric hyperoxia. An apparatus or system useful for treating, preventing, or ameliorating cardiovascular disease includes an airtight chamber configured to accommodate and enclose a subject, and including at least one hatch to allow entry or exit of the subject; a vacuum source for adjusting pressure within the chamber to a level sufficient to maintain hypobaria; and a gas source for introducing one or more gases into the chamber, such as oxygen in an amount sufficient to produce a condition of normoxia or hyperoxia within the chamber, while maintaining hypobaria.

The invention discloses a hyperoxia ventilating pore plate device for organoid sphere culture. The device comprises a pore cover plate (1), a culture pore unit (2) and a pore plate base (3), wherein the pore plate base (3) is provided with a cavity (30) with a through bottom hole (31), and the culture pore unit (2) is embedded in the cavity (30). By arranging the through bottom hole as a ventilating window, the cell culture process can be ensured to have a sufficient dissolved oxygen environment, the problem of insufficient dissolved oxygen at the bottom of the near-pore plate of the organoidcell sphere is solved, the rapid growth of the organoid cell sphere is effectively promoted, the cell activity is improved, the cell culture efficiency is increased, and disintegration and apoptosis of the organoid cell sphere caused by long-term culture are avoided; and a new research tool is expected to be provided for constructing a three-dimensional organoid cell sphere model with relatively high oxygen demand. Compared with existing culture devices in the market, the device has the advantages that the gas mass transfer efficiency is higher, the boundary of cultured organoid cell spheres is clear, the cell aggregation compactness is high, and the disintegration phenomenon is avoided.

The present disclosure concerns the use of a phosphodiesterase inhibitor, such as, for example, sildenafil, to repair a brain and / or a retinal injury in a newborn. The phosphodiesterase inhibitor can be used in a premature or a term baby that has been exposed to hyperoxia or hypoxia which caused a brain and / or a retinal injury.

The present invention discloses a primer set for rapidly detecting chronic obstructive pulmonary diseases, wherein the primers HO-1F: FAM-AGAGCCTGCAGCTTCTCAGA and HO-1R: ACAAAGTCTGGCCATAGGAC are designed by using the SSR locus in the promoter sequence of HO-1 as a target sequence according to the conserved sequences on both sides of the SSR locus. According to the present invention, the H0-1 is close to the anti-oxidation effect of the body, is mainly distributed in alveolar macrophages, and has anti-inflammatory and anti-oxidation effects, wherein the expression of the H0-1 can be induced bysmoking, hypoxia and hyperoxia; the HO-1 gene is located on human chromosome 22 (22q12), wherein the gene promoter region GT repeat polymorphism acts by affecting the expression of the HO-1; and the L-type allele of the HO-1 gene promoter region (GT repetitive sequence, n is more than 30) can reduce the expression of the HO-1 in smoking patients, such that the anti-oxidation capacity of the body is weakened so as to promote the occurrence of COPD.

The invention discloses a hyperoxia sweat gland dredging instrument comprising a chassis; a controller, a power supply and an air pump are installed inside the chassis. The outside of the chassis is provided with a power cord electrically connected with the power supply; the outer wall of the chassis can be detachably connected with one end of the connecting pipe, and the other end of the connecting pipe is provided with a connecting head; the connecting head is provided with a heating pipe, an air outlet pipe, a water level sensor and a water temperature sensor; a sleeve made of Muyu stone isarranged on the connecting head, a plurality of uniformly distributed through holes are arranged on the surface of the sleeve, and the heating pipe, the air outlet pipe, the water level sensor and the water temperature sensor are all located in the sleeve. The hyperoxia sweat gland dredging instrument integrates various health care functions, can oxygenate and heat the liquid medicine at constanttemperature to promote absorption of the liquid medicine, and is equipped with Muyu stone and magnet to play a health care function; so as to accelerate blood circulation, promote perspiration and expel toxins in the body, have the effects of dispelling cold, dampness, heat, detoxification and detoxification, be convenient to operate, and be suitable for people of different ages.