Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

36 results about "Hyperoxia" patented technology

Hyperoxia occurs when cells, tissues and organs are exposed to an excess supply of oxygen (O₂) or higher than normal partial pressure of oxygen. In medicine, it refers to excess oxygen in the lungs or other body tissues, which can be caused by breathing air or oxygen at pressures greater than normal atmospheric pressure. This kind of hyperoxia can lead to oxygen toxicity, caused from the harmful effects of breathing molecular oxygen at elevated partial pressures. Hyperoxia is the opposite of hypoxia; hyperoxia refers to a state in which oxygen supply is excessive, and hypoxia refers to a state in which oxygen supply is insufficient.

Pyridyl-substituted porphyrin compounds and methods of use thereof

The present invention relates to Pyridyl-Substituted Porphyrin Compounds, compositions comprising an effective amount of a Pyridyl-Substituted Porphyrin Compound and methods for treating or preventing injury due to exposure to a reactive species, erectile dysfunction due to surgery, lung disease, hyperoxia, neurodegenerative disease, liver disease, myocardial damage during cardioplegia, an inflammatory condition, a reperfusion injury, an ischemic condition, a cardiovascular disease, diabetes, a diabetic complication, cancer, a side effect of cancer chemotherapy, or a radiation-induced injury, or to prolong the half-life of an oxidation-prone compound, comprising administering to a subject in need thereof an effective amount of a Pyridyl-Substituted Porphyrin Compound.
Owner:INOTECK PHARMA CORP

N-benzyl substituted pyridyl porphyrin compounds and methods of use thereof

The present invention relates to N-Benzyl-Substituted Pyridyl Porphyrin Compounds, compositions comprising an effective amount of an N-Benzyl-Substituted Pyridyl Porphyrin Compound and methods for treating or preventing injury due to exposure to a reactive species, erectile dysfunction, urinary incontinence, lung disease, hyperoxia, neurodegenerative disease, liver disease, myocardial damage during cardioplegia, an inflammatory condition, a reperfusion injury, an ischemic condition, a cardiovascular disease, diabetes, a diabetic complication, cancer, a side effect of cancer chemotherapy, or a radiation-induced injury, and methods for prolonging the half-life of an oxidation-prone compound, comprising administering to a subject in need thereof an effective amount of an N-Benzyl-Substituted Pyridyl Porphyrin Compound.
Owner:INOTECK PHARMA CORP

Optical physiologic sensors and methods

Physiologic sensors and methods of application are described. These sensors function by detecting recently discovered variations in the spectral optical density at two or more wavelengths of light diffused through the skin. These variations in spectral optical density have been found to consistently and uniquely relate to changes in the availability of oxygen in the skin tissue, relative to the skin tissue's current need for oxygen, which we have termed Physiology Index (PI). Current use of blood gas analysis and pulse oximetry provides physiologic insight only to blood oxygen content and cannot detect the status of energy conversion metabolism at the tissue level. By contrast, the PI signal uniquely portrays when the skin tissue is receiving ‘less than enough oxygen,’‘just the right amount of oxygen,’ or ‘more than enough oxygen’ to enable aerobic energy conversion metabolism. The PI sensor detects one pattern of photonic response to insufficient skin tissue oxygen, or tissue hypoxia, (producing negative PI values) and a directly opposite photonic response to excess tissue oxygen, or tissue hyperoxia, (producing positive PI values), with a neutral zone in between (centered at PI zero). Additionally, unique patterns of PI signal response have been observed relative to the level of physical exertion, typically with a secondary positive-going response trend in the PI values that appears to correspond with increasing fatigue. The PI sensor illuminates the skin with alternating pulses of selected wavelengths of red and infrared LED light, then detects the respective amount of light that has diffused through the skin to an aperture located a lateral distance from the light source aperture. Additional structural features include means of internally excluding light from directly traveling from the light emitters to the photodetector within the sensor. This physiology sensor and methods of use offer continuous, previously unavailable information relating to tissue-level energy conversion metabolism. Several alternative embodiments are described, including those that would be useful in medical care, athletics, and personal health maintenance applications.
Owner:REVEAL BIOSENSORS INC

Hyperoxic breathing system

A controlled enhanced-oxygen (hyperoxic) breathing system involving an oxygen source, a control valve system and a breathing interface, is disclosed. The control valve system may include a demand flow valve and a venturi valve arranged to introduce ambient air into an oxygen stream to provide a desired level of oxygen in the resultant hyperoxic air stream. Alternatively, the control valve system may include a nitrogen-removal unit, such as nitrogen scrubber, to increase the oxygen content above that of ambient air. The control valve system may further include a one-way flow valve and may further be joined to a plenum for storing hyperoxic air. The hyperoxic breathing system is typically connected to a breathing mask for use by an individual undergoing exercise or physical training activities.
Owner:LAST TO FIRST LLC

Method for preparing multi-nuclear-shell hollow nickel-nickel silicate-CeO2 through methane reforming

The invention discloses a method for preparing multi-nuclear-shell hollow nickel-nickel silicate-CeO2 through methane reforming. The method includes the steps of (1) preparing silicon dioxide nanoparticles; (2) adding nickel precursors into the silicon dioxide nanoparticles, and preparing hollow nickel silicate spheres at the temperature of 50-220oC; (3) dispersing the hollow nickel silicate spheres into mixed liquor of ethyl alcohol and water, adding CeO2 precursors and precipitators, and performing reaction at the temperature of 40-150oC to obtain nickel silicate-CeO2 nuclear shell hollow nanospheres; (4) reducing the nickel silicate-CeO2 nuclear shell hollow nanospheres to obtain the high-dispersion nickel-nickel silicate-CeO2 multi-nuclear-shell hollow catalyst. The prepared multi-nuclear-shell hollow nickel-nickel silicate-CeO2 catalyst has the advantages of high sintering resistance on nickel and CeO2, hyperoxia hole concentration, high carbon deposition resistance, high nickel dispersity, high CeO2 dispersity and the like, and displays high catalytic activity and carbon deposition resistance when being applied to catalytic reaction based on low-temperature methane reforming.
Owner:GUIZHOU INST OF TECH

Application of oridonin powder aerosol in treatment of acute lung injury

The invention discloses application of oridonin powder aerosol in treatment of acute lung injury. The oridonin powder aerosol is prepared by an oridonin nano-drug delivery system, wherein the dosage form of the nano-drug delivery system is selected from lipidosome, nanoparticles, nanosuspension, nanoemulsion and micro-emulsion. The medicines in the oridonin powder aerosol are stable, easily enter the deep parts of lung tissues, are positioned in a targeted mode and are convenient to carry and use, and the treatment of acute lung injury is promoted. The oridonin powder aerosol is used for treating the acute lung injury caused by infection, shock, smoking, trauma, toxin poisoning, inhalation of irritant gases, radiation, high oxygen and low oxygen, wherein the inhaled irritant gases comprise phosgene, diphosgene, triphosgene, chlorine, nitric oxides, formaldehyde, dimethyl sulfate, hydrogen chloride, hydrogen bromide, hydrogen fluoride, ammonia, ozone and sulfur dioxide.
Owner:INST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA

High oxygen and ozone supersonic atomization face-beautifying method

InactiveCN1836649AIndirect regulation of immunityIncrease loopUltrasound therapyCosmetic preparationsMetaboliteWhole body
The high oxygen and ozone ultrasonically atomizing method is that O2 in 99 % over concentration and atomized water particle are formed high O2 mist acting directly onto skin or O2, O3 the ozone generator produces and atomized water particle are sprayed to skin or ultrasonically introduced to skin, so as to reach the comprehensive beautifying and health care effects. The present invention has the functions of cleaning skin, killing bacteria in skin and pores, expanding local blood vessels to improve micro circulation, increasing local and systematic oxygen supply, strengthening cell immunity to delay senility, eliminating free radical, promoting metabolism, etc.
Owner:西安星愿科技有限责任公司

Pyridyl-substituted porphyrin compounds and methods of use thereof

The present invention relates to Pyridyl-Substituted Porphyrin Compounds, compositions comprising an effective amount of a Pyridyl-Substituted Porphyrin Compound and methods for treating or preventing injury due to exposure to a reactive species, erectile dysfunction due to surgery, lung disease, hyperoxia, neurodegenerative disease, liver disease, myocardial damage during cardioplegia, an inflammatory condition, a reperfusion injury, an ischemic condition, a cardiovascular disease, diabetes, a diabetic complication, cancer, a side effect of cancer chemotherapy, or a radiation-induced injury, or to prolong the half-life of an oxidation-prone compound, comprising administering to a subject in need thereof an effective amount of a Pyridyl-Substituted Porphyrin Compound.
Owner:INOTECK PHARMA CORP

Apparatus and Methods for Controlling Tissue Oxygenation for Wound Healing and Promoting Tissue Viability

A non-invasive tissue oxygenation system for accelerating the healing of damaged tissue and to promote tissue viability is disclosed herein. The system is comprised of a lightweight portable electrochemical oxygen concentrator, a power management system, microprocessors, memory, a pressure sensing system, an optional temperature monitoring system, oxygen flow rate / oxygen partial pressure monitoring and control system, a display screen and key pad navigation controls as a means of providing continuous variably controlled low dosages of oxygen to a wound site and monitoring the healing process. A kink resistant oxygen delivery tubing, whereby the proximal end is removably connected to the device and the distal end with holes or a flexible, flat, oxygen-permeable tape is positioned at or near the wound bed as a means of applying near 100% pure oxygen to the wound site. The distal end of the tube is in communication with the electrochemical oxygen concentrator and wound monitoring system to communicate oxygen partial pressure and, where appropriate, temperature information. A moisture absorbent dressing is positioned over the distal end of the tubing at the wound site and a reduced moisture vapor permeable dressing system is positioned whereby covering the moisture absorbent dressing, distal end of tubing and wound site creating a restricted or occluded airflow enclosure. The restricted airflow enclosure allows the out-of-the-way control and display unit to provide a controlled hyperoxia and hypoxia wound site for accelerated wound healing.
Owner:ELECTROCHEM OXYGEN CONCEPTS

Hyperoxic breathing system

A controlled enhanced-oxygen (hyperoxic) breathing system involving an oxygen source, a control valve system and a breathing interface, is disclosed. The control valve system may include a demand flow valve and a venturi valve arranged to introduce ambient air into an oxygen stream to provide a desired level of oxygen in the resultant hyperoxic air stream. Alternatively, the control valve system may include a nitrogen-removal unit, such as nitrogen scrubber, to increase the oxygen content above that of ambient air. The control valve system may further include a one-way flow valve and may further be joined to a plenum for storing hyperoxic air. The hyperoxic breathing system is typically connected to a breathing mask for use by an individual undergoing exercise or physical training activities.
Owner:LAST TO FIRST LLC

Novel atmospheric-pressure intermittent hypoxic and hyperoxic training equipment and system and training method of equipment

The invention relates to novel atmospheric-pressure intermittent hypoxia and hyperoxia training equipment and system and a training method of the equipment. The training equipment feeds back the flowand pressure of various gases in real time through a gas control module. A gas production module controls the pressure, the gas production and the proportion and flow of mixed gas according to a command to achieve atmospheric pressure and generation of hypoxia and hyperoxia gases. A breathing training module mixes the various gases generated by the gas production module into the mixed gas used fortraining, the mixed gas is exchanged with outside air to achieve air balance, and the atmospheric-pressure hypoxia and hyperoxia mixed gas is generated, so that the training equipment achieves atmospheric-pressure alternating hypoxia and hyperoxia training. Atmospheric-pressure intermittent hypoxia and hyperoxia training is conducted, intelligent control is achieved, the hypoxia and hyperoxia alternating time and the exposure time in hypoxia and hyperoxia are regulated dynamically, and thus the equipment can deal with a specific situation larger or smaller than extreme life indicators in time. The IHT technology can be safely applied to the fields of disease treatment, prevention and rehabilitation of people in need.
Owner:SHENZHEN SINO RUSSIA MEDICAL TECH CO LTD

High-oxygen drinking water production process and system based on gas nanocrystallization technology

The invention provides a high-oxygen drinking water production process based on a gas nanocrystallization technology. The process comprises the following steps: water source water is filtered by a quartz sand filter and an activated carbon filter in sequence and then enters a water cooling device, and cooling water is further filtered by a precision filter and an ultrafilter in sequence after thewater pressure of the cooling water is increased by a raw water booster pump, is stored in a purified water tank, enters a degassing device for degassing after being sterilized by an environment-friendly sterilization device, and is stored in a nitrogen-sealed water tank; medical-grade oxygen is fed into an oxygen tank through an oxygen booster pump; water and oxygen are mixed in a gas-liquid mixing pump and then enter a spiral cutter to be subjected to gas-liquid cutting to form first-stage high-oxygen water, and then the first-stage high-oxygen water enters a sawtooth ejector to form high-concentration high-oxygen water; and the high-concentration high-oxygen water enters a security filter to remove foreign matters, then flows into the water tank of a filling machine, and is filled intoa container through an all-in-one machine to prepare high-oxygen drinking water. According to the invention, continuous production can be realized, and the produced high-oxygen water-soluble oxygen isstable and retains mineral elements and trace elements necessary for human metabolism.
Owner:JIANGNAN UNIV

Operator-Portable Power Supply of Maximum Specific Energy

The present invention relates to a system and method for providing power of maximum relevant specific energy. The system is more particularly defined as an operator-portable power supply utilizing a fuel containing hydrogen peroxide for energy, coupled with water and oxygen recovery, storage and delivery means. Extracting energy, water, and oxygen from the hydrogen peroxide fuel and refining to consumable forms (electrical, pneumatic, hydraulic, etc. energy; potable water; breathable oxygen) is for the purpose of increasing the overall energy output of the power supply per carried mass. The resultant water displaces water otherwise requiring transportation by the operator and the oxygen allows for hyperoxic respiration, increasing the metabolic power output of the operator.
Owner:BARRON DAVID

Alda-1 treatment and prevention of pulmonary disease

Methods of treating or preventing allergic or pulmonary diseases characterized by endothelial dysfunction with Alda-1 are presented. Treatment of pulmonary endothelial cells subjected to hyperoxia with Alda-1 showed an increase in ALDH2 activity and expression. Treatment with Alda-1 also illustrated a decrease in oxidative stress, a decrease in reactive oxygen species (ROS), a decrease in apoptosis, a decrease in inflammation and an enhancement of mitochondrial membrane potential.
Owner:UNIV OF SOUTH FLORIDA

Attenuation of hyperoxia-induced cell death with mitochondrial aldehyde dehydrogenase

Oxygen toxicity is one of the major risk factors in the development of the chronic lung disease or bronchopulmonary dysplasia in premature infants. Using proteomic analysis, we discovered mitochondrial aldehyde dehydrogenase (mtALDH or ALDH2) was down-regulated in neonatal rat lung after hyperoxic exposure. To study the role of mtALDH in hyperoxic lung injury, we overexpressed mtALDH in human lung epithelial cells (A549) and found that mtALDH significantly reduced hyperoxia-induced cell death. Compared to control cells (Neo-A549), the necrotic cell death in mtALDH overexpressing cells (mtALDH-A549) decreased from 25.3% to 6.5%, 50.5% to 9.1% and 52.4% to 15.06% after 24-, 48- and 72-hour hyperoxic exposure, respectively. The levels of intracellular and mitochondria-derived reactive oxygen species (ROS) in mtALDH-A549 cells after hyperoxic exposure were significantly lowered compared to Neo-A549 cells. mtALDH overexpression significantly stimulated extracellular signal regulated kinase (ERK) phosphorylation under normoxic and hyperoxic conditions. Inhibition of ERK phosphorylation partially eliminated the protective effect of mtALDH in hyperoxia-induced cell death, suggesting ERK activation by mtALDH conferred cellular resistance to hyperoxia. mtALDH overexpression augmented Akt phosphorylation and maintained the total Akt level in mtALDH-A549 cells under normoxic and hyperoxic conditions. Inhibition of PI3K activation by LY294002 in mtALDH-A549 cells significantly increased necrotic cell death after hyperoxic exposure, indicating that PI3K / Akt activation by mtALDH played an important role in cell survival after hyperoxia. Taken together, these data demonstrate that mtALDH overexpression attenuates hyperoxia-induced cell death in lung epithelial cells through reduction of ROS, activation of ERK / MAPK and PI3K / Akt cell survival signaling pathways.
Owner:CHILDRENS MERCY HOSPITAL

Method for producing a useful compound and treating a wastewater using pure oxygen

A method of using pure oxygen in microbial fermentation processes and wastewater treatment processes, in which the pure oxygen is produced by a pressure swing adsorption (PSA) process from a gas mixture of air and unused oxygen-containing recycled off-gas from microbial processes which uses oxygen-containing gas in a liquid or gas state. When pure oxygen with a purity of more than 90% is used in microbial processes, microbial productivity can be about 5 times as increased as it is that in the conventional method using air with an oxygen content of 21%, and the volume of an active sludge tank in wastewater treatment processes can be reduced to at most ⅕ of the volume as compared to the conventional method. Also, the off-gas from such pure oxygen processes has a high oxygen content of about 70-80%. Thus, when the off-gas is recycled with air for the supplement of oxygen consumption, the gas mixture with an oxygen content of about 40% is used as feed gas for the PSA process, and CO2 generated by microbial breathing is also removed. Thus, the volume of a PSA column and an air compressor for supplying the feed gas can be reduced to less than ½ of the volume as compared to that of the use of air.
Owner:E1 BIOTECH +1

Method for precision cancer treatment by identifying drug resistance

InactiveUS20200113476A1Efficient microcirculation tumor region exchangeIncrease in signal intensityImage enhancementMedical imagingBaseline dataTumor response
A method for precision cancer treatment by identifying drug resistance is provided. In some embodiments, the method may include: detecting tumor oxygenated perfusion by having a patient breathe air to acquire MRI baseline data; inhalation of hyperoxia gas to generate higher than baseline HbO2 blood circulating in body to acquire MRI enhanced data; the region-of-interest (ROI), which in this case is a tumor volume (V0), and which may be performed by volume contour tracing / region-of-interest (ROI) analysis and 3D tumor volumetry methods; calculating voxel's enhanced signal intensity (ΔSI); calculating tumor oxygenated perfusion percentage (OPP %); selecting different threshold and calculating maps such as a reconstruction OPP % pseudo color map; calculating tumor volume change ratio (Vt %); overlaying reconstruction OPP % pseudo color map to original images for visualizing tumor response data; drawing or plotting the OPP % and Vt % on a cancer treatment response information diagram, and identifying the type of drug resistance, classifying the drug resistance being caused by poor drug distribution factor or cells-specific factor based on pooled collected data.
Owner:JIANG LAN

ALDA-1 treatment and prevention of pulmonary disease

Methods of treating or preventing allergic or pulmonary diseases characterized by endothelial dysfunction with Alda-1 are presented. Treatment of pulmonary endothelial cells subjected to hyperoxia with Alda-1 showed an increase in ALDH2 activity and expression. Treatment with Alda-1 also illustrated a decrease in oxidative stress, a decrease in reactive oxygen species (ROS), a decrease in apoptosis, a decrease in inflammation and an enhancement of mitochondrial membrane potential.
Owner:UNIV OF SOUTH FLORIDA

Enhancement of vasodilatory function and lowering of effective systemic vascular resistance

A method for treating, preventing, or ameliorating cardiovascular disease in a subject involves exposing the subject for an effective duration to a condition of hypobaric normoxia or hypobaric hyperoxia. An apparatus or system useful for treating, preventing, or ameliorating cardiovascular disease includes an airtight chamber configured to accommodate and enclose a subject, and including at least one hatch to allow entry or exit of the subject; a vacuum source for adjusting pressure within the chamber to a level sufficient to maintain hypobaria; and a gas source for introducing one or more gases into the chamber, such as oxygen in an amount sufficient to produce a condition of normoxia or hyperoxia within the chamber, while maintaining hypobaria.
Owner:THE GOVERNORS OF THE UNIV OF ALBERTA

Hyperoxia ventilating pore plate device for organoid sphere culture

The invention discloses a hyperoxia ventilating pore plate device for organoid sphere culture. The device comprises a pore cover plate (1), a culture pore unit (2) and a pore plate base (3), wherein the pore plate base (3) is provided with a cavity (30) with a through bottom hole (31), and the culture pore unit (2) is embedded in the cavity (30). By arranging the through bottom hole as a ventilating window, the cell culture process can be ensured to have a sufficient dissolved oxygen environment, the problem of insufficient dissolved oxygen at the bottom of the near-pore plate of the organoidcell sphere is solved, the rapid growth of the organoid cell sphere is effectively promoted, the cell activity is improved, the cell culture efficiency is increased, and disintegration and apoptosis of the organoid cell sphere caused by long-term culture are avoided; and a new research tool is expected to be provided for constructing a three-dimensional organoid cell sphere model with relatively high oxygen demand. Compared with existing culture devices in the market, the device has the advantages that the gas mass transfer efficiency is higher, the boundary of cultured organoid cell spheres is clear, the cell aggregation compactness is high, and the disintegration phenomenon is avoided.
Owner:江苏信安佳医疗科技有限公司

Abnormal blood oxygenation level monitoring system and method, and self-monitoring oxygenation system and method

Described are various embodiments of a self-monitoring oxygenation system and method. In one embodiment, a system is provided for monitoring for abnormal blood oxygenation levels. The system comprises: an optical spectroscopy probe for acquiring blood oxygenation data representative of deoxyhemoglobin levels over time; and a digital data processor operatively connected to said probe and programmedto: monitor relative variations in said deoxyhemoglobin levels to output a signal representative of a higher health risk rating of hyperoxia.
Owner:SPECTRONIX INC

Non-surgical intervened fish artificial lung system and application thereof

ActiveCN111096255AMaintain a specific homeostatic environmentStrong handlingMeasurement devicesClimate change adaptationDiseaseAnimal science
The invention discloses a non-surgical intervened fish artificial lung system. The non-surgical intervened fish artificial lung system comprises a film exchange system which can adjust parameters of any one or several including O2 partial pressure, CO2 partial pressure, H<+> concentration and HCO3<-> of breeding liquid, can be used for establishing an animal model simulating a human respiratory system, and can be applied to research of human respiration diseases of hyoxemia, hyperoxemia, hypocapnia, hypercarbia and the like.
Owner:TIANJIN CHEST HOSPITAL +1

Method for prolonging cooled meat shelf period by combination of chilling and high concentration oxygen modified atmospheric packaging

The invention discloses a method for prolonging cooled meat shelf period by combination of chilling and high concentration oxygen modified atmospheric packaging; the method is based on the study of the preservative effect of cooled meat by the combination of chilling and oxygen modified atmospheric of different concentration; the method sets up six experimental groups, comprising chilling, freezing(4 DEG C), vacuum packing and chilling, 20% of CO2+ 80% of O2(hyperoxia) + chilling, 20% of CO2 + 20% of O2+ 60% of N2 + chilling and 20% of CO2 + 80% of N2(oxygen free) + chilling and measures total plate count, TVBN, drip loss rate, water retaining capacity and color difference. The invention has the following advantages: the total plate count 24d under the condition of chilling and high concentration oxygen does not exceed the health standard of cooled meat; high concentration oxygen modified atmospheric can maintain the color of cooled meat to change in a small range during the whole storage period; by using the method combining chilling and high concentration oxygen modified atmospheric packaging, the shelf period cooled meat can be prolonged and color of cooled meat can be maintained, and cooled meat can be kept fresh for above twenty four days.
Owner:SHANGHAI OCEAN UNIV

Methods of assessing metabolic function

The present invention relates to improved methods for determining metabolic function in tissues of an animal. In particular, the invention relates to methods for determining the penumbra in ischaemic tissues using MRI techniques in association with hyperoxic conditions and an oxygen carrier. The invention also relates to systems adapted to perform the methods.
Owner:AURUM BIOSCI LTD

Treatment of retinopathy of prematurity (ROP)

ActiveUS9820981B2Preserve retinal vesselsAvoid damageOrganic active ingredientsSenses disorderRetinal blood vesselsOxygen poison
Disclosed herein are methods of treating retinopathy of prematurity (ROP) in a premature and / or low birth weight infant in need thereof, comprising administering to the infant an effective amount of a compound represented by Structural Formula I, Structural Formula la or Structural Formula II described herein, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of inhibiting the destruction of retinal blood vessels in a premature and / or low birth weight infant in need thereof, comprising administering to the infant an effective amount of a compound represented by Structural Formula I, Structural Formula la or Structural Formula II, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of treating hyperoxia in a premature and / or low birth weight infant in need thereof, comprising administering to the infant an effective amount of a compound represented by Structural Formula I, Structural Formula la or Structural Formula II, or a pharmaceutically acceptable salt thereof. By using the methods disclosed herein, particularly when an infant is hyperoxic, oxygen toxicity to the retina of the eye can be inhibited without restricting oxygen supplementation, which is often necessary to sustain the life of premature infants.
Owner:THE CLEVELAND CLINIC FOUND

Hyperoxia compound glycine pyridoxal electrolyte injecta

The invention discloses hyperoxia compound glycine pyridoxal electrolyte injecta which contains high-concentration dissolved oxygen, electrolyte, mannitol and piracetam. After intravenous infusion, the hyperoxia compound glycine pyridoxal electrolyte injecta can not only play a conventional role of dehydration, but also notably improve oxygen content of blood, replenish loss of the electrolyte caused by the dehydration, play important roles in lightening electrolyte disturbance and protecting important viscera from anoxia damage, and be safely and widely used to cure encephaledema, reduce intracranial pressure and intraocular pressure, effectively reduces occurrence rates of various complications, and has good double functions of cerebral protection. A plurality of kinds of effective composite ingredients contained by the hyperoxia compound glycine pyridoxal electrolyte injecta respectively reduce working concentration and working dosage of single drug. The hyperoxia compound glycine pyridoxal electrolyte injecta greatly reduces injection pains and renal toxicity, overcomes three big difficult problems that mannitol is crystallized below 15 DEG C and the like, is favorable for being used for emergency treatment at different environment temperatures, and has rather important clinical application values, and wide social and economic benefits.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Phosphodiesterase inhibitors to repair brain and/or retinal injury in human newborns

The present disclosure concerns the use of a phosphodiesterase inhibitor, such as, for example, sildenafil, to repair a brain and / or a retinal injury in a newborn. The phosphodiesterase inhibitor can be used in a premature or a term baby that has been exposed to hyperoxia or hypoxia which caused a brain and / or a retinal injury.
Owner:WINTERMARK PIA

A method for harvesting hematopoietic stem cells from the placenta in a hypoxic environment

ActiveCN108949686BAvoid non-physiological oxygen stress responseIncrease the number ofCell dissociation methodsCulture processDispasePlacenta
The invention relates to the technical field of methods for obtaining hematopoietic stem cells, in particular to a method for obtaining hematopoietic stem cells from placenta in a hypoxic environment. The process of obtaining the hematopoietic stem cells in the placenta of the present invention is all completed under the normal hypoxic environment conditions in a simulated organism; serum mixture. The method for obtaining hematopoietic stem cells from the placenta of the present invention overcomes the problem of non-physiological oxygen pressure stress caused by transient hyperoxia, and the obtained hematopoietic stem cells are large in number, primitive in state, and have good proliferation and differentiation capabilities in vitro.
Owner:希瑞干细胞科技有限公司

Primer set for rapidly detecting chronic obstructive pulmonary diseases, and preparation method thereof

The present invention discloses a primer set for rapidly detecting chronic obstructive pulmonary diseases, wherein the primers HO-1F: FAM-AGAGCCTGCAGCTTCTCAGA and HO-1R: ACAAAGTCTGGCCATAGGAC are designed by using the SSR locus in the promoter sequence of HO-1 as a target sequence according to the conserved sequences on both sides of the SSR locus. According to the present invention, the H0-1 is close to the anti-oxidation effect of the body, is mainly distributed in alveolar macrophages, and has anti-inflammatory and anti-oxidation effects, wherein the expression of the H0-1 can be induced bysmoking, hypoxia and hyperoxia; the HO-1 gene is located on human chromosome 22 (22q12), wherein the gene promoter region GT repeat polymorphism acts by affecting the expression of the HO-1; and the L-type allele of the HO-1 gene promoter region (GT repetitive sequence, n is more than 30) can reduce the expression of the HO-1 in smoking patients, such that the anti-oxidation capacity of the body is weakened so as to promote the occurrence of COPD.
Owner:SHANGHAI PASSION BIOTECHNOLOGY CO LTD

Hyperoxia sweat gland dredging instrument

The invention discloses a hyperoxia sweat gland dredging instrument comprising a chassis; a controller, a power supply and an air pump are installed inside the chassis. The outside of the chassis is provided with a power cord electrically connected with the power supply; the outer wall of the chassis can be detachably connected with one end of the connecting pipe, and the other end of the connecting pipe is provided with a connecting head; the connecting head is provided with a heating pipe, an air outlet pipe, a water level sensor and a water temperature sensor; a sleeve made of Muyu stone isarranged on the connecting head, a plurality of uniformly distributed through holes are arranged on the surface of the sleeve, and the heating pipe, the air outlet pipe, the water level sensor and the water temperature sensor are all located in the sleeve. The hyperoxia sweat gland dredging instrument integrates various health care functions, can oxygenate and heat the liquid medicine at constanttemperature to promote absorption of the liquid medicine, and is equipped with Muyu stone and magnet to play a health care function; so as to accelerate blood circulation, promote perspiration and expel toxins in the body, have the effects of dispelling cold, dampness, heat, detoxification and detoxification, be convenient to operate, and be suitable for people of different ages.
Owner:张存杰
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products