33 results about "Hyperoxia" patented technology

The present invention relates to Pyridyl-Substituted Porphyrin Compounds, compositions comprising an effective amount of a Pyridyl-Substituted Porphyrin Compound and methods for treating or preventing injury due to exposure to a reactive species, erectile dysfunction due to surgery, lung disease, hyperoxia, neurodegenerative disease, liver disease, myocardial damage during cardioplegia, an inflammatory condition, a reperfusion injury, an ischemic condition, a cardiovascular disease, diabetes, a diabetic complication, cancer, a side effect of cancer chemotherapy, or a radiation-induced injury, or to prolong the half-life of an oxidation-prone compound, comprising administering to a subject in need thereof an effective amount of a Pyridyl-Substituted Porphyrin Compound.

Physiologic sensors and methods of application are described. These sensors function by detecting recently discovered variations in the spectral optical density at two or more wavelengths of light diffused through the skin. These variations in spectral optical density have been found to consistently and uniquely relate to changes in the availability of oxygen in the skin tissue, relative to the skin tissue's current need for oxygen, which we have termed Physiology Index (PI). Current use of blood gas analysis and pulse oximetry provides physiologic insight only to blood oxygen content and cannot detect the status of energy conversion metabolism at the tissue level. By contrast, the PI signal uniquely portrays when the skin tissue is receiving ‘less than enough oxygen,’‘just the right amount of oxygen,’ or ‘more than enough oxygen’ to enable aerobic energy conversion metabolism. The PI sensor detects one pattern of photonic response to insufficient skin tissue oxygen, or tissue hypoxia, (producing negative PI values) and a directly opposite photonic response to excess tissue oxygen, or tissue hyperoxia, (producing positive PI values), with a neutral zone in between (centered at PI zero). Additionally, unique patterns of PI signal response have been observed relative to the level of physical exertion, typically with a secondary positive-going response trend in the PI values that appears to correspond with increasing fatigue. The PI sensor illuminates the skin with alternating pulses of selected wavelengths of red and infrared LED light, then detects the respective amount of light that has diffused through the skin to an aperture located a lateral distance from the light source aperture. Additional structural features include means of internally excluding light from directly traveling from the light emitters to the photodetector within the sensor. This physiology sensor and methods of use offer continuous, previously unavailable information relating to tissue-level energy conversion metabolism. Several alternative embodiments are described, including those that would be useful in medical care, athletics, and personal health maintenance applications.

A controlled enhanced-oxygen (hyperoxic) breathing system involving an oxygen source, a control valve system and a breathing interface, is disclosed. The control valve system may include a demand flow valve and a venturi valve arranged to introduce ambient air into an oxygen stream to provide a desired level of oxygen in the resultant hyperoxic air stream. Alternatively, the control valve system may include a nitrogen-removal unit, such as nitrogen scrubber, to increase the oxygen content above that of ambient air. The control valve system may further include a one-way flow valve and may further be joined to a plenum for storing hyperoxic air. The hyperoxic breathing system is typically connected to a breathing mask for use by an individual undergoing exercise or physical training activities.

The invention provides a high-oxygen drinking water production process based on a gas nanocrystallization technology. The process comprises the following steps: water source water is filtered by a quartz sand filter and an activated carbon filter in sequence and then enters a water cooling device, and cooling water is further filtered by a precision filter and an ultrafilter in sequence after thewater pressure of the cooling water is increased by a raw water booster pump, is stored in a purified water tank, enters a degassing device for degassing after being sterilized by an environment-friendly sterilization device, and is stored in a nitrogen-sealed water tank; medical-grade oxygen is fed into an oxygen tank through an oxygen booster pump; water and oxygen are mixed in a gas-liquid mixing pump and then enter a spiral cutter to be subjected to gas-liquid cutting to form first-stage high-oxygen water, and then the first-stage high-oxygen water enters a sawtooth ejector to form high-concentration high-oxygen water; and the high-concentration high-oxygen water enters a security filter to remove foreign matters, then flows into the water tank of a filling machine, and is filled intoa container through an all-in-one machine to prepare high-oxygen drinking water. According to the invention, continuous production can be realized, and the produced high-oxygen water-soluble oxygen isstable and retains mineral elements and trace elements necessary for human metabolism.

A method for precision cancer treatment by identifying drug resistance is provided. In some embodiments, the method may include: detecting tumor oxygenated perfusion by having a patient breathe air to acquire MRI baseline data; inhalation of hyperoxia gas to generate higher than baseline HbO₂ blood circulating in body to acquire MRI enhanced data; the region-of-interest (ROI), which in this case is a tumor volume (V₀), and which may be performed by volume contour tracing/region-of-interest (ROI) analysis and 3D tumor volumetry methods; calculating voxel's enhanced signal intensity (ΔSI); calculating tumor oxygenated perfusion percentage (OPP %); selecting different threshold and calculating maps such as a reconstruction OPP % pseudo color map; calculating tumor volume change ratio (Vt %); overlaying reconstruction OPP % pseudo color map to original images for visualizing tumor response data; drawing or plotting the OPP % and Vt % on a cancer treatment response information diagram, and identifying the type of drug resistance, classifying the drug resistance being caused by poor drug distribution factor or cells-specific factor based on pooled collected data.

The invention discloses a hyperoxia ventilating pore plate device for organoid sphere culture. The device comprises a pore cover plate (1), a culture pore unit (2) and a pore plate base (3), wherein the pore plate base (3) is provided with a cavity (30) with a through bottom hole (31), and the culture pore unit (2) is embedded in the cavity (30). By arranging the through bottom hole as a ventilating window, the cell culture process can be ensured to have a sufficient dissolved oxygen environment, the problem of insufficient dissolved oxygen at the bottom of the near-pore plate of the organoidcell sphere is solved, the rapid growth of the organoid cell sphere is effectively promoted, the cell activity is improved, the cell culture efficiency is increased, and disintegration and apoptosis of the organoid cell sphere caused by long-term culture are avoided; and a new research tool is expected to be provided for constructing a three-dimensional organoid cell sphere model with relatively high oxygen demand. Compared with existing culture devices in the market, the device has the advantages that the gas mass transfer efficiency is higher, the boundary of cultured organoid cell spheres is clear, the cell aggregation compactness is high, and the disintegration phenomenon is avoided.

The present disclosure concerns the use of a phosphodiesterase inhibitor, such as, for example, sildenafil, to repair a brain and/or a retinal injury in a newborn. The phosphodiesterase inhibitor can be used in a premature or a term baby that has been exposed to hyperoxia or hypoxia which caused a brain and/or a retinal injury.

The present invention discloses a primer set for rapidly detecting chronic obstructive pulmonary diseases, wherein the primers HO-1F: FAM-AGAGCCTGCAGCTTCTCAGA and HO-1R: ACAAAGTCTGGCCATAGGAC are designed by using the SSR locus in the promoter sequence of HO-1 as a target sequence according to the conserved sequences on both sides of the SSR locus. According to the present invention, the H0-1 is close to the anti-oxidation effect of the body, is mainly distributed in alveolar macrophages, and has anti-inflammatory and anti-oxidation effects, wherein the expression of the H0-1 can be induced bysmoking, hypoxia and hyperoxia; the HO-1 gene is located on human chromosome 22 (22q12), wherein the gene promoter region GT repeat polymorphism acts by affecting the expression of the HO-1; and the L-type allele of the HO-1 gene promoter region (GT repetitive sequence, n is more than 30) can reduce the expression of the HO-1 in smoking patients, such that the anti-oxidation capacity of the body is weakened so as to promote the occurrence of COPD.