Method for breeding mung bean flowering pollination mutant based on CRISPR/Cas9 gene editing technology and special gRNA

A gene editing and mutant technology, applied in the field of molecular breeding, genetic engineering and molecular biology, to achieve the effect of simple method and high success rate

Inactive Publication Date: 2018-10-12
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF1 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, obtaining mutants by mutagenesis is random and accidental

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for breeding mung bean flowering pollination mutant based on CRISPR/Cas9 gene editing technology and special gRNA
  • Method for breeding mung bean flowering pollination mutant based on CRISPR/Cas9 gene editing technology and special gRNA
  • Method for breeding mung bean flowering pollination mutant based on CRISPR/Cas9 gene editing technology and special gRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 is used to edit the design of the gRNA of cha gene

[0026] According to the principle of CRISPR / Cas9 gene editing, the protospacer adjacent motif (PAM, "NGG", where "N" is any nucleotide) of the sequence of the gene cha shown in SEQ ID NO.1 is the gRNA. sequence. If the first nucleotide at the 5' end of the gRNA is not guanine (G), add a G to the 5' end, and the gRNA is 21 nt long. All gRNAs designed in gene cha are shown in Table 1. The gRNA sequence should be on the exon, not too close to the ATG initiator, and should be in the front and middle of the entire gene. The gRNA was compared to the mung bean gene green database (http: / / plantgenomics.snu.ac.kr / mediawiki-1.21.3 / index.php / Main_Page) by Blast, and the target sequence was determined to be unique on the mung bean genome.

[0027] Table 1 gRNA sequence

[0028]

[0029]

Embodiment 2

[0030] Embodiment 2 is used for the construction of the CRISPR carrier of editing cha

[0031] The framework of the CRISPR vector for editing cha is pYAO:hSpCas9 (Yan L, Wei S, Wu Y, et al. High-efficiency genome editing in Arabidopsis using YAO promoter-driven CRISPR / Cas9system[J].Molecular plant,2015,8( 12):1820-1823.), the construction method of the CRISPR carrier for editing cha is as follows:

[0032] Synthesize forward and reverse oligonucleotide chains 1) 5'-ATTG[20N or 21N]-3' and 2) 5'-AAAC[20n or 21n]-3'. Where "20N or 21N" is the gRNA sequence shown in Table 1, 20n or 21n is the reverse complementary sequence of the gRNA shown in Table 1, for example, the reverse complementary sequence of GGACCGGCACCTATGATGATAGG is CCTATCATCATAGGTGCCGGTCC. The gRNA specifically used in this example and Example 3 is the fifth sequence GATGTTGAAGTGTGAGGCGTAGG in Table 1.

[0033] Anneal the positive and negative oligonucleotide chains 1) and 2), the scheme is: a. dissolve the oligon...

Embodiment 3

[0040] Example 3 Transformation of mung bean plants with CRISPR plasmids

[0041] Referring to the method of Zhao et al. (2017), mung bean plants were transformed with the pYAO:hSpCas9-target-sgRNA plasmid mediated by magnetic nanocarriers. The plasmid of MNP (PolyMag1000, purchased from Chemicell) was diluted to 1 μg / μl with ultrapure water, mixed at 1:4 and incubated at room temperature for 30 minutes to form the MNP-plasmid complex. Add the MNP-plasmid complex to 1ml pollen medium (every 100ml contains 15g sucrose, 0.03g Ca(NO 3 ) 2 4H 2 O, 0.01g H 3 BO 3 ) among.

[0042] In the early morning, 100 mg of pollen was collected from the flower organs of mung bean and placed in a petri dish, and the MNP-plasmid complex suspension was added to fully infiltrate the pollen. Cover the petri dish and place it on a MagnetoFACTOR-24 magnetic plate (purchased from Chemicell) for 0.5 hour to perform magnetic pollen transformation. Then, the water in the upper layer was carefully ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for breeding a mung bean flowering pollination mutant based on CRI SPR / Cas9 gene editing technology and a special gRNA. The method comprises the following steps of: transferring the CRISPR / Cas9 plasmid of a plant containing a gRNA sequence into a mung bean, and thereby, editing the ORF region of the Cha gene of the mung bean shown in SEQ ID NO. 1, wherein the DNA sequence corresponding to the gRNA is shown in any one of SEQ ID NO. 2 to SEQ NO. 21. According to the invention, a gene for coding the YUCCA protein of the mung bean is edited by using the CRISPR / Cas9gene editing technology, and a new mung bean germplasm with missing keel petals and exposed stigmas and anther is obtained, thus providing a basis for cross breeding of mung beans.

Description

technical field [0001] The present invention relates to the fields of molecular breeding, genetic engineering and molecular biology. Specifically, the present invention relates to a method for breeding mung bean flowering and pollination mutants based on CRISPR / Cas9 gene editing technology and a special gRNA. Background technique [0002] Mung bean (Vigna radiate L.) is one of the main edible bean crops in my country. It is rich in vitamins and minerals, dietary fiber, and protein, and is deeply loved by consumers. However, mung bean varieties are all conventional varieties with low yield, and the yield is generally only 1000 to 1500 kg / ha. Due to the low yield, it is difficult to compete with other field crops, and the area continues to shrink. Therefore how to substantially increase the mung bean yield is an urgent problem that the majority of mung bean breeders must face and solve. [0003] The utilization of hybrid vigor is one of the ways to increase crop yield. Hete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/113A01H5/02A01H6/54
CPCC12N15/113C12N15/8213C12N15/827C12N2310/10
Inventor陈景斌拔杰·宋他崔晓艳林云袁星星顾和平李群三陈新
OwnerJIANGSU ACADEMY OF AGRICULTURAL SCIENCES