Reagent for nucleic acid real-time isothermal amplification, amplification system and amplification method and application of amplification system
A constant temperature amplification and nucleic acid technology, applied in the field of biochemistry and molecular biology, to achieve good sensitivity and specificity, suitable for clinical promotion and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] This embodiment is the quantitative detection of nucleic acid of hepatitis C virus.
[0055] (1) Reagents: Hepatitis C virus nucleic acid national reference material (300012-201302) was purchased from China National Institutes for Food and Drug Control; QIAamp Viral RNA Mini Kit, T7 RNA polymerase, AS Taq DNA polymerase, RNA inhibitor and RNase H were all purchased from Suzhou Snapp Biotechnology Co., Ltd.
[0056] (2) Primers and probes:
[0057] F: GAGTAGIGTTGGGTIGCGAA
[0058] R: AATTTAATACGACTCACTATAGGGA -GTGCACGGTITACGAGACCTC
[0059] P: FAM-TGCCTGATAGGGTGCTTGCGAGTGC-BHQ1
[0060] Underlined is the T7 RNA Polymerase promoter sequence.
[0061] (3) RNA extraction: For the detailed extraction process, please refer to the kit instructions. A brief introduction is as follows: take 300ul serum, add 1200ul Buffer AVL, mix thoroughly for 15 seconds, and lyse at room temperature for 15 minutes. Add 1200ul absolute ethanol or glycerol and mix well for 15 seconds. Tr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


