Bacillus velezensis and application of bacillus velezensis as aquatic pathogenic bacteria inhibitor
A technology of aquatic pathogens and bacillus, applied in the fields of application, bacteria, antibacterial drugs, etc., can solve the problems of lack of antagonistic probiotics, weak foundation of probiotic screening and application research, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The screening of embodiment 1 bacterial strain
[0039] 1 Isolation and purification of gut bacteria from tilapia
[0040] Refer to the method of Olsson et al. (For specific process, please refer to Olsson C, Westerdahl A, Conwa Y P L, et al. Environ Micro, 1992,58 (2): 551-556.), cut about 2cm of tilapia anterior, middle and hindgut respectively, extrude intestinal contents, cut into pieces with aseptic surgical scissors, and then remove Rinse with deionized water 2 to 3 times, add 1 mL of sterile deionized water each, and fully oscillate the homogenate on an oscillator. Centrifuge at 1000r / min for 1min, take the supernatant and dilute it by 10-fold dilution method to obtain 1-fold, 10-fold and 100-fold diluted bacterial suspension respectively, take 300μL each and evenly spread it on the BHI solid medium, and place it at 28°C for constant temperature cultivation Box culture 1 ~ 2d. Single colonies with different shapes were picked for repeated streaking and purific...
Embodiment 2
[0044] 1 Strain activation and preparation of fermentation broth
[0045] Streak the preserved LF01 strain screened in Example 1 on the BHI solid medium, culture it at 28°C for 24h, then use an inoculation loop to scrape a single colony into the BHI liquid medium, culture it with shaking at 30°C and 200r / min for 12h as a seed liquid. Transfer to BHI liquid medium at a ratio of 1:50 (V / V), culture at 30°C and shake at 200r / min for 48 hours to obtain a fermentation broth.
[0046] 2gyrA Gene Sequence Cloning and Sequence Analysis
[0047] The genomic DNA of the LF01 strain was extracted according to the instructions of the bacterial genomic DNA extraction kit, and the extracted genomic DNA was stored in a -20°C refrigerator for later use. Using LF01 genomic DNA as a template, through primers
[0048] BgyrA-F: 5′–ATTCACGCTATCACTGACTTATTC–3′
[0049] and
[0050] BgyrA-R: 5′–ATGGGAGACAAAAGTAGAACCGAG–3′
[0051] The gyrA gene fragment of the LF01 strain was amplified.
[005...
Embodiment 3
[0057] Example 3 Extraction of Antagonist Substance and Antibacterial Effect Measurement
[0058] Concentrated hydrochloric acid precipitation method (the following three documents are recorded: 1) Zhang Shaobo. Anti-Xanthomonas oryzae deep-sea Mycobacillus dudii A493 and its active substances [D]. Huazhong Agricultural University, 2011.2) Hou Baohong. Bai Lai Analysis and preparation of antibacterial active substances of Bacillus sp. TS-1203 [D]. Gansu Agricultural University, 2016.3) Zhang Xiaoyun. Isolation, identification and activity analysis of antibacterial substances of Bacillus subtilis strain CAB-1 [D]. Hebei Agricultural University, 2011.) Extract:
[0059] Take 1L of the fermentation culture broth of LF01 strain, centrifuge it at 7500r / min for 10min, take the supernatant and slowly add 1mol / L hydrochloric acid (HCl) until the pH of the supernatant is about 2, at this time, white flocs are precipitated, after overnight at 4°C Centrifuge at 7500r / min for 10min, coll...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


