Check patentability & draft patents in minutes with Patsnap Eureka AI!

Bacillus velezensis and application of bacillus velezensis as aquatic pathogenic bacteria inhibitor

A technology of aquatic pathogens and bacillus, applied in the fields of application, bacteria, antibacterial drugs, etc., can solve the problems of lack of antagonistic probiotics, weak foundation of probiotic screening and application research, etc.

Active Publication Date: 2018-10-19
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the screening and application of probiotics for aquatic animal disease prevention and control is weak, and antagonistic probiotics that can be used for disease prevention and control are very scarce, which is far from meeting the urgent needs of aquatic animal disease prevention and control.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus velezensis and application of bacillus velezensis as aquatic pathogenic bacteria inhibitor
  • Bacillus velezensis and application of bacillus velezensis as aquatic pathogenic bacteria inhibitor
  • Bacillus velezensis and application of bacillus velezensis as aquatic pathogenic bacteria inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The screening of embodiment 1 bacterial strain

[0039] 1 Isolation and purification of gut bacteria from tilapia

[0040] Refer to the method of Olsson et al. (For specific process, please refer to Olsson C, Westerdahl A, Conwa Y P L, et al. Environ Micro, 1992,58 (2): 551-556.), cut about 2cm of tilapia anterior, middle and hindgut respectively, extrude intestinal contents, cut into pieces with aseptic surgical scissors, and then remove Rinse with deionized water 2 to 3 times, add 1 mL of sterile deionized water each, and fully oscillate the homogenate on an oscillator. Centrifuge at 1000r / min for 1min, take the supernatant and dilute it by 10-fold dilution method to obtain 1-fold, 10-fold and 100-fold diluted bacterial suspension respectively, take 300μL each and evenly spread it on the BHI solid medium, and place it at 28°C for constant temperature cultivation Box culture 1 ~ 2d. Single colonies with different shapes were picked for repeated streaking and purific...

Embodiment 2

[0044] 1 Strain activation and preparation of fermentation broth

[0045] Streak the preserved LF01 strain screened in Example 1 on the BHI solid medium, culture it at 28°C for 24h, then use an inoculation loop to scrape a single colony into the BHI liquid medium, culture it with shaking at 30°C and 200r / min for 12h as a seed liquid. Transfer to BHI liquid medium at a ratio of 1:50 (V / V), culture at 30°C and shake at 200r / min for 48 hours to obtain a fermentation broth.

[0046] 2gyrA Gene Sequence Cloning and Sequence Analysis

[0047] The genomic DNA of the LF01 strain was extracted according to the instructions of the bacterial genomic DNA extraction kit, and the extracted genomic DNA was stored in a -20°C refrigerator for later use. Using LF01 genomic DNA as a template, through primers

[0048] BgyrA-F: 5′–ATTCACGCTATCACTGACTTATTC–3′

[0049] and

[0050] BgyrA-R: 5′–ATGGGAGACAAAAGTAGAACCGAG–3′

[0051] The gyrA gene fragment of the LF01 strain was amplified.

[005...

Embodiment 3

[0057] Example 3 Extraction of Antagonist Substance and Antibacterial Effect Measurement

[0058] Concentrated hydrochloric acid precipitation method (the following three documents are recorded: 1) Zhang Shaobo. Anti-Xanthomonas oryzae deep-sea Mycobacillus dudii A493 and its active substances [D]. Huazhong Agricultural University, 2011.2) Hou Baohong. Bai Lai Analysis and preparation of antibacterial active substances of Bacillus sp. TS-1203 [D]. Gansu Agricultural University, 2016.3) Zhang Xiaoyun. Isolation, identification and activity analysis of antibacterial substances of Bacillus subtilis strain CAB-1 [D]. Hebei Agricultural University, 2011.) Extract:

[0059] Take 1L of the fermentation culture broth of LF01 strain, centrifuge it at 7500r / min for 10min, take the supernatant and slowly add 1mol / L hydrochloric acid (HCl) until the pH of the supernatant is about 2, at this time, white flocs are precipitated, after overnight at 4°C Centrifuge at 7500r / min for 10min, coll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides bacillus velezensis and application of the bacillus velezensis as an aquatic pathogenic bacteria inhibitor. The bacillus velezensis is separated from the intestinal canal of healthy tilapia, and the preservation number of the bacterial strain is GDMCC No. 60344. The bacillus velezensis has a broad-spectrum antagonistic aquatic common pathogenic bacteria function, and has theadvantages that the growth of the pathogenic bacteria, such as streptococcus agalactiae, streptococcus iniae,nocardia seriolea, aeromonas hydrophila, aeromonas schubertii and edwardsiella tarda, canbe effectively inhibited, the use is safe, no residue is generated, reducing the usage amount and the residual amount of chemical drugs in aquaculture is facilitated, the production cost is reduced, and the practicality is strong.

Description

technical field [0001] The invention relates to the technical field of application of aquatic microorganisms, in particular to a bacillus velesi and its application as an inhibitor of aquatic pathogens. Background technique [0002] my country's aquaculture production ranks first in the world for many years in a row. Aquaculture not only provides people with a rich source of protein, but also effectively increases the income of fishermen. It plays an important role in the process of my country's agricultural development. Due to the continuous pursuit of intensification, high-density farming and frequent use of drugs in the process of aquaculture in my country for many years, frequent outbreaks of aquaculture animal diseases have restricted the healthy and sustainable development of aquaculture in my country. Among them, the common bacterial pathogens in the process of aquaculture mainly include Aeromonas hydrophila, Aeromonas victoria, Aeromonas schewii, Vibrio harveii, Vibr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A61K35/742A61P31/04A23K10/18A23K50/80C12R1/07
CPCA61K2035/115A23K10/18A23K50/80A61P31/04C12N1/20C12N1/205C12R2001/07
Inventor 张德锋高艳侠卢迈新可小丽刘志刚衣萌萌王淼曹建萌
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More