Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lipidosome composite as well as application and method for reducing content of biogenic amine in mackerel fish sauce

A technology of liposome complexes and cationic liposomes, applied in biochemical equipment and methods, food science, DNA/RNA fragments, etc., can solve problems such as difficult degradation, difficult application and promotion, and ineffective effects

Active Publication Date: 2018-11-23
ZHEJIANG GONGSHANG UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Biogenic amines are stable in nature and not easy to degrade at high temperatures. At present, the main methods to reduce biogenic amines include ultra-high pressure method, irradiation method, and adding additives from external sources. Food quality and other shortcomings, it is difficult to apply and promote in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lipidosome composite as well as application and method for reducing content of biogenic amine in mackerel fish sauce
  • Lipidosome composite as well as application and method for reducing content of biogenic amine in mackerel fish sauce
  • Lipidosome composite as well as application and method for reducing content of biogenic amine in mackerel fish sauce

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of liposome complexes:

[0039] (1) si-luxR Design and synthesize the molecule si-luxR that interferes with the luxR gene according to the amine-related gene luxR (see Appendix) of the main amine-producing bacterium Enterobacter cloacae in fish sauce. The si-luxR sequence is:

[0040] Justice Chain: UUAAUAUGCAAGUUUAGCGAG;

[0041] Antisense strand: CGCUAAACUUGCAUAUUAAGA.

[0042] T7 promoter template DNA is 5'-TAATACGACTCACTATAGGAGACAGG-3'.

[0043] (2) Synthesis of si-luxR by in vitro transcription method: Mix 3 μL siRNA sense strand (100 μmol / L) and 3 μL T7 promoter primer template (100 μmol / L), pre-denature at 95°C for 3 minutes, ice-bath for 25 minutes, and then add 3 μL 10xKlenow buffer, 8 μL deoxynucleoside triphosphate (dNTP) (10 μmol / L), 2 μL ddH2O, 2.5 μL Klenow enzyme (2U / uL), 37 ° C water bath for 30 minutes. Take 6 μL of reaction solution, add 4 μL of buffer, 5 μL of nucleoside triphosphate (rNTP) mixture (25 mmol / L), 2.5 μL of ddH2O and 2.5 ...

Embodiment 2

[0055] Preparation of liposome complexes:

[0056] Wherein the preparation of si-luxR is the same as in Example 1.

[0057] (1) Preparation of blank cationic liposomes: Weigh 25 mg of soybean lecithin, N-(1-(2,3 dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP ) 35 mg, cholesterol 25 mg, distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG2000) 15 mg, dissolved in chloroform-methanol (volume ratio 3:2), and rotary evaporated to form a film. The thin lipid film was hydrated in a 5% glucose solution followed by shaking and the resulting liposomes were extruded 8 times through a 100 nm polycarbonate membrane to obtain a cationic liposome solution of approximately 10 mg / mL.

[0058] (2) Preparation of liposome complex L-ecl-si-luxR: si-luxR and blank cationic liposome were respectively dissolved in 1% diethylpyrocarbonate water, and mixed overnight. And the ratio of the total positive charges carried by cationic liposomes to the total negative charges carr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a lipidosome composite as well as application thereof in reducing the content of biogenic amine in mackerel fish sauce. The application mainly comprises the following steps: (1) designing and preparing siRNA (small interfering ribonudeoacid) according to main amine producing bacteria enterobacter cloacae ATCC 13047 and amine producing relevant genes luxR sequence in the mackerel fish sauce; (2) preparing stable siRNA-cationic liposome by adopting siRNA (small interfering ribonudeoacid) as an encapsulated substance; and (3) adding the stable siRNA-cationic liposome intothe fish sauce fermented solution according to a given method at the preliminary stage of the fermentation. By adopting the method, the effect for reducing the biogenic amine generated in the fish sauce fermentation process is significant, the flavor and color of the fish sauce are not influenced, and the important significance for controlling the content of the biogenic amine in the fish sauce can be achieved.

Description

technical field [0001] The invention belongs to the field of food quality and safety, and relates to the combination of siRNA (small interfering ribonucleic acid) and lipids to form a liposome that is stable and capable of encapsulating nucleic acids, and is used to reduce the content of biogenic amines in fish sauce made from mackerel Methods. Background technique [0002] As a brown liquid condiment with a special flavor, fish sauce has gained popularity in most parts of Southeast Asia, where it is one of the sources of protein intake in the local people's daily diet. Because of its special flavor, fish sauce has been widely used in various prepared foods, homemade foods and sauces in Japan and European countries. It is obtained by fermenting and decomposing the protein and other substances contained in the raw material under the joint action of the protease contained in the fish and even the beneficial microorganisms. Since the production process of fish sauce is an ope...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A23L27/24A23L5/10C12N15/113
CPCA23L5/10A23L27/24C12N15/113C12N2310/14
Inventor 王彦波傅玲琳吴哲铭王飞飞黎凡王翀周瑾茹
Owner ZHEJIANG GONGSHANG UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com