Protein carrier for protein transduction and preparation method and application thereof

A protein and carrier technology, applied in the field of cell biology, can solve the problems of toxicological effects, unexplained, safety hazards, etc., and achieve the effect of simple experimental operation.

Active Publication Date: 2018-12-28
ZHEJIANG GONGSHANG UNIVERSITY
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the target protein contains CTA, which may have potential toxicological effects, and there are certain safety hazards and risks
In addition, the invention only shows that the target protein can target the drug into the brain, but does not say whether it can enter other parts or cells, and the application field is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein carrier for protein transduction and preparation method and application thereof
  • Protein carrier for protein transduction and preparation method and application thereof
  • Protein carrier for protein transduction and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Construction of embodiment 1 plasmid vector pEX-4T-MBP-EGFP

[0061] Use the PCR method to obtain MBP and EGFP gene fragments respectively from wild-type plasmids containing MBP and EGFP, and first clone the MBP gene fragment (amino acid sequence such as SEQ ID NO.2, DNA sequence such as SEQ ID NO.5) into pGEX-4T -1 vector, replace the original GST tag in the vector, and then insert multiple restriction sites to obtain the recombinant plasmid pEX-4T-MBP, and then insert the EGFP gene fragment (amino acid sequence such as SEQ ID NO.4, DNA After the sequence such as SEQ ID NO.7) is inserted into the Mre I restriction site after MBP, the recombinant plasmid pEX-4T-MBP-EGFP is obtained, and its construction diagram is shown in figure 1 As shown, the specific experimental steps are as follows:

[0062] (1) MBP replaces GST label:

[0063] Table 1 The amount of PCR reagents used for MBP gene fragments

[0064]

[0065] The amount of reagents used is shown in Table 1. Fi...

Embodiment 2

[0082] Construction of embodiment 2 plasmid vector pEX-4T-MBP-CTB-EGFP

[0083] The construction flow chart of pEX-4T-MBP-CTB-EGFP is as follows Figure 4 shown. The amount of reagents is shown in Table 5. Search the CTB gene sequence (amino acid sequence such as SEQ ID NO.3, DNA sequence such as SEQ ID NO.6) through NCBI, optimize the sequence to make it suitable for expression in Escherichia coli, and insert it at the front and rear ends Homologous fragment (including restriction enzyme site) of the cloning site (NotI site) in the 20bp destination vector (pEX-4T-MBP-EGFP), synthesized by General Biosystems (Anhui) Co., Ltd. Homologous fragment 1 -CTB-homologous segment 2 gene. Using primers:

[0084] Forward: 5'—ACAAGGACGACGATGACAAG—3', SEQ ID NO.12;

[0085] Reverse: 5'—TGGTGATGATGATGATGATGATG—3', SEQ ID NO.13;

[0086] The homologous fragment 1-CTB-homologous fragment 2 gene was amplified by PCR, the amplification conditions are shown in Table 6, using a high-fidelity...

Embodiment 3

[0092] Embodiment 3 recombinant protein is expressed in Escherichia coli

[0093] (1) Obtain engineering bacteria

[0094] Transform the recombinant plasmid pEX-4T-MBP-CTB-EGFP obtained in Example 2 into Escherichia coli BL21, spread it on LB agar (containing 1‰Amp), pick a single colony after culturing at 37°C for 16 hours, and inoculate In 5mL LB broth (containing 1‰Amp) at 37°C, 200r / min, cultivate for 16h to obtain engineering bacteria.

[0095] (2) induction

[0096] Inject the engineered bacteria obtained in 1 into 300mL LB broth (containing 1‰Amp) at a ratio of 1:100, and cultivate to OD at 37°C and 200r / min 600 When it is 0.6-1.0 (about 3h), add IPTG (final concentration is 0.1mmol / L), immediately place it at 16°C, 200r / min, and cultivate for 16-24h. 4000r / min, 20min, centrifuge at room temperature to collect the bacterial cells, and weigh.

[0097] (3) Enzymatic hydrolysis combined with ultrasonic crushing

[0098] According to the wet weight of the bacteria: enz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein carrier for protein transduction and a preparation method and application thereof. The protein carrier adopts genetic engineering means to perform fusion expression on maltose binding protein (MBP) having foreign protein solubleness for promoting fusion expression, cholera toxin B subunit (CTB) which is non-toxic but has a transmembrane function and an enhanced green fluorescent protein (EGFP), to obtain an oligomeric protein (MCTB-EGFP) which is non-toxic, has soluble expression and has a transmembrane effect. The EGFP is replaced with other proteins, and a foreign protein can enter a cell through common incubation with the cell, so that various mechanisms within the cell are studied and related cell therapy is carried out.

Description

technical field [0001] The invention belongs to the field of cell biology, in particular to a protein carrier used for protein transduction, its preparation method and application. Background technique [0002] In the fields of biology and medicine, proteins, antibodies, enzymes, peptides, etc. are commonly used to study intracellular activities (intracellular material transport, expression regulation) and intracellular therapy, but they cannot penetrate the cell membrane, and it is difficult to non-destructively treat them. These exogenous macromolecules are imported into living cells, thereby limiting their applications. [0003] At present, in experiments and clinics, most of the transfection methods are used to transfer the DNA of foreign proteins into cells, but the transfection method is only applicable to a few specific cells, such as HEK 293T cells, and its application range is limited, and for general cells However, the transfection efficiency was very low. [000...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70
CPCC07K14/195C07K2319/24C12N15/70
Inventor傅玲琳谢梦华王彦波王翀周瑾茹王飞飞王顺余钱怡黄健健
OwnerZHEJIANG GONGSHANG UNIVERSITY