Unlock instant, AI-driven research and patent intelligence for your innovation.

A label-free fluorescence detection method for Staphylococcus aureus mecA gene and detection kit thereof

A detection kit and fluorescence detection technology, applied in the field of analysis and detection, can solve the problems of unfavorable rapid on-site detection, limited wide application, cumbersome operation, etc., and achieve the effects of convenient and rapid popularization, cost reduction, and high sensitivity

Active Publication Date: 2019-01-15
GUANGDONG INST OF ECO ENVIRONMENT & SOIL SCI
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods require separation and enrichment of the samples to be tested, which is cumbersome and time-consuming, and is not conducive to rapid on-site detection
In recent years, the use of biosensors to detect pathogenic bacteria has attracted much attention. Analytical techniques such as fluorescence, electrochemical and colorimetry have been established, but most of them require labeling, which limits the wide application of these techniques

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A label-free fluorescence detection method for Staphylococcus aureus mecA gene and detection kit thereof
  • A label-free fluorescence detection method for Staphylococcus aureus mecA gene and detection kit thereof
  • A label-free fluorescence detection method for Staphylococcus aureus mecA gene and detection kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A detection kit for label-free fluorescent detection of Staphylococcus aureus, comprising the following components:

[0037] (1) Hairpin probe HP, the sequence is as follows:

[0038] HP: 5'-GGGTAGGGCGGGTTGGGATTGGGATCA (region I)-TAGCGTCAT (region II)-TGATCCCAATCCCAACCCGCCCTACCC (region III)-CTATGATCCCAAT (region IV)-3' (SEQ ID NO: 5);

[0039] (2) Exo III and 1×NEBuffer buffer;

[0040](3) 20mM Tris-HCl buffer solution containing 100mM NaCl, 10mM MgCl 2 , 15 mM KCl, pH=7.4.

[0041] A method for label-free fluorescent detection of Staphylococcus aureus is carried out according to the following steps:

[0042] (1) Formation of hairpin probe HP. Heat the hairpin probe HP at a concentration of 10 μM in a water bath at 90°C for 10 minutes, then slowly cool to room temperature;

[0043] (2) Detection of the mecA gene of Staphylococcus aureus. First, 2 μL of the solution to be tested was added to 38 μL Tris-HCl buffer solution containing 300 nM hairpin probe HP and 37....

Embodiment 2

[0045] Detection of different concentrations of Staphylococcus aureus mecA gene:

[0046] Prepare Staphylococcus aureus mecA gene standard solution, the concentration is 0, 10fM, 10 2 fM, 10 3 fM, 10 4 fM, 10 5 fM, 10 6 fM, 10 7 fM, 10 8 fM and 10 9 fM, stored at 4°C.

[0047] The mecA gene solutions of different concentrations were added to the reaction system described in Example 1, and the fluorescence intensity of the system was observed after sufficient reaction. The results were as follows: figure 2 ( figure 2 A: at λ ex = Under the condition of 399nm, the emission spectrum corresponding to different mecA gene concentrations; figure 2 B: at lambda ex =399nm condition, λ em =610nm fluorescence standard curve; ), 10fM of the mecA gene can produce obvious changes in fluorescence, indicating that its detection limit <10fM. As the concentration of mecA gene increased, the fluorescence intensity also increased, and gradually tended to saturation.

Embodiment 3

[0049] Specificity experiment:

[0050] Prepare 10 nM standard solutions of different nucleic acids, which are M1, M2, M3 and NC.

[0051] M1:5'-ATTGGGAT G ATAGCGTCATT-3' (SEQ ID NO: 6),

[0052] M2:5'-ATTGGGAT G ATA C CGTCATT-3' (SEQ ID NO: 7);

[0053] M3:5'-ATTG C GAT G ATA C CGTCATT-3' (SEQ ID NO: 8);

[0054] NC:5'- TGCCGCTCATCCGCCACATA -3' (SEQ ID NO: 9).

[0055] The underlined letters represent mismatched bases.

[0056] 10nM different interfering substance standard solutions and 10nM mecA gene solution were added to the reaction system described in Example 1, and the fluorescence changes of the system were observed after sufficient reaction. The results were as follows: image 3 As shown, the fluorescence intensities of M1, M2, M3 and NC at 10 nM are far lower than those of the mecA gene at 10 nM, and the fluorescence intensities of the M1 system and M2 are 32% and 1% of the mecA gene, respectively. The fluorescence intensity of the M3 system and NC is th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a label-free fluorescence detection method of Staphylococcus aureus mecA gene and a detection kit, belonging to the analysis and detection field. A strategy in which clip probeHP is combined with exonuclease Exo III assisted target signal cascade recycle amplification is adopted. In G-quadruplex is adopted as a signal reporter molecule to detect mecA gene of Staphylococcusaureus without label. The method and the kit simplify the operation and reduces the cost. The whole detection process is characterized by rapid response, simple, free of mark and high sensitivity, and can be easily popularized without professional training. The detection method and the detection kit of the invention have important significance for the rapid detection of Staphylococcus aureus in the environment or food.

Description

technical field [0001] The invention belongs to the field of analysis and detection, and in particular relates to a label-free fluorescence detection method for the mecA gene of Staphylococcus aureus and a detection kit. Background technique [0002] Staphylococcus aureus (Staphylococcus aureus) is the most important pathogenic bacteria causing human and animal infections, and it is ubiquitous in the environment and food. Even at low concentrations, Staphylococcus aureus can endanger the life and health of humans and animals, such as causing acute pneumonia, sepsis, toxic shock and other diseases. [0003] At present, the routine detection methods of Staphylococcus aureus mainly include microarray, polymerase chain reaction, high-throughput sequencing and surface plasmon resonance and other methods. These methods require separation and enrichment of the samples to be tested, which are cumbersome and time-consuming, and are not conducive to rapid on-site detection. In recen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/14C12R1/445
CPCC12Q1/689
Inventor 陈俊华李琼潘家峰周丹华施晨露潘苏红
Owner GUANGDONG INST OF ECO ENVIRONMENT & SOIL SCI