A kind of construction method of β-hydroxy-β-methylbutyric acid-producing engineering bacteria
A technology of methylbutyric acid and engineering bacteria, which is applied in the construction field of Yarrowia lipolytica, can solve problems such as difficult separation and purification, complex components of reaction products, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1: Inactivation of five genes in the Yarrowia lipolytica genome
[0055] 1.1 Select the chassis cells as the target of metabolic pathway change
[0056] Yarrowia lipolytica ATCC MYA-2613 (purchased from the American Type Culture Collection (ATCC), USA) was used as the host bacteria, that is, the chassis cells. In order to alter its fatty acid degradation metabolic pathway (see figure 1 ), selected and constructed plasmids for targeted shearing of these five genes.
[0057] Use plasmid pCRISPRyl (purchased from Addgene), reference (Schwartz, C.M., M.S.Hussain, M.Blenner and I.Wheeldon. Synthetic RNA Polymerase III Promoters Facilitate High-Efficiency CRISPR–Cas9-Mediated Genome Editing in Yarrowialipolytica.ACS Synthetic Biology. 2016,5(4):356-359.), the following plasmids were constructed, as shown in Table 1.
[0058] Table 1
[0059] Plasmid name target gene sgRNA used pCRISPRyl-pox2 YALI0F10857g GCUGGAGUUCGGGCUGCUGU pCRISPRyl-p...
Embodiment 2
[0080] Example 2: Integration of exogenous genes in Yarrowia lipolytica
[0081] 2.1 Design of expression cassettes for exogenous genes
[0082] LiuC, AibA and AibB genes derived from Myxococcus xanthus (also known as Myxococcus xanthus) and TesB genes derived from Escherichia coli were expressed in the gene spliced strain obtained in Example 1. LiuC (uniprot: Q1D5Y4), AibA (uniprot: Q1D414), AibB (uniprot: Q1D413) and TesB (uniprot: P0AGG2) were synthesized after codon optimization by Suzhou Jinweizhi Biotechnology Co., Ltd. respectively. The promoters, genes and terminators to be used are shown in Table 3 below.
[0083] table 3
[0084] promoter number promoter name gene number gene name terminator number terminator name A TEF1p 1 Liu C α Xpr2t B EXP1p 2 AibA β Mig1t C GPD 3 AibB gamma Lip2t D GPM1p 4 TesB Ω Lip1t
[0085] In the present invention, the URA3 gene is selected as the screening marke...
Embodiment 3
[0098] Embodiment 3: fermentation verification
[0099] Fermentation verification was carried out on the positive transformants identified and obtained in Example 2, and the transformants were respectively inoculated into YPD4 medium for fermentation. The highest HMB yield of positive transformants was 10g / L. On the contrary, in the host bacteria without gene knockout of fatty acid metabolism pathway, even if the above HMB biosynthesis pathway was integrated, no HMB product was found in positive transformants.
[0100] The above experimental results show that the Yarrowia lipolytica engineering bacteria constructed in the present invention can directly produce HMB through fermentation, and realize the effective accumulation of HMB in the fermentation broth. Those skilled in the art can easily understand that, compared with the chemical synthesis method, the biosynthesis method of the present invention has the natural advantage of being green and environment-friendly, and thus...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


