Verticillium wilt resistant associated protein GbVIP1, coding gene and application thereof

A technology of resistance to verticillium wilt and related proteins, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of long breeding cycle, lack of germplasm resources, and inability to popularize large-scale sea island cotton with resistance to verticillium wilt

Active Publication Date: 2019-02-01
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a lack of germplasm resources for upland cotton immunity and high resistance to Verticillium dahliae in my country, and sea-island cotton resistant to Verticillium dahlias cannot be widely promoted. In addition, the traditional breeding cycle is long and the efficiency is low, resulting in the selection of Verticillium dahlia-resistant varieties by traditional breeding methods The progress is slow, so many researchers use modern genetic engineering technology to find the key protein of cotton resistance to Verticillium wilt, and use the disease resistance protein combined with molecular breeding methods to select cotton varieties resistant to Verticillium wilt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Verticillium wilt resistant associated protein GbVIP1, coding gene and application thereof
  • Verticillium wilt resistant associated protein GbVIP1, coding gene and application thereof
  • Verticillium wilt resistant associated protein GbVIP1, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Cloning, sequence and expression analysis of embodiment 1GbVIP1 gene

[0038] Plant the sea-island cotton variety Hai 7124, take cotton leaves at the seedling stage, grind the cotton leaves into powder with liquid nitrogen, use the EASYspin Plus Plant RNA Rapid Extraction Kit (Adelaide) to extract total RNA from cotton leaves, and use the reverse transcription kit (TakaRa) cDNA was synthesized.

[0039] The synthesized cDNA was used as a template to amplify GbVIP1, and the primer sequence used was F: 5'TACGCCGCCGCTTCTTCCGCCTACA3'; R: 5'CTTACCAAGCATTTCCTTCCAACAT3' (as shown in SEQ ID NO: 3-4).

[0040] Use high-fidelity Taq enzyme KOD-Plus-Neo (TOYOBO) to amplify GbVIP1, the 20ul reaction system is as follows, 10×PCR buffer for KOD-Plus-Neo, 0.2mM dNTPs, 1.5mM MgSO 4 , 0.3uM forward primer and 0.3uM reverse primer, 0.4U KOD-Plus-Neo, 200mM cDNA, the amplification program was 94°C for 4min, 98°C for 10s, 60°C for 1min, 68°C for 1min; 34 cycles, 68°C for 5min, Take the amp...

Embodiment 2

[0043] The acquisition of the expression vector of embodiment 2GbVIP1 gene, recombinant expression cell and transgenic tobacco

[0044] Construct the GbVIP1 gene into the expression vector pBI121 to obtain a recombinant expression vector, start the expression of the gene with the 35S promoter, terminate the expression of the gene with the NOS terminator, and use the kanamycin gene as a screening marker. The specific method is as follows, using Example 1 The resulting recombinant vector GbVIP1-pLB was used as a template, with primers F: acgggggactctagaggatccTACGCCGCCGCTTCTTCC, R: cgatcggggaaattcgagctcCTTACCAAGCATTTCCTTCCAAC (as shown in SEQ ID NO: 7-8) amplified to obtain the PCR product of the GbVIP1 gene sequence, and using the restriction enzyme SacI The pBI121 vector was digested with BamHI to obtain a linearized plasmid with a restriction site, and the PCR product was constructed into the overexpression vector pBI121 using a homologous recombination kit (ClonExpress II OneS...

Embodiment 3

[0054] Functional analysis of embodiment 3GbVIP1

[0055] (1) Analysis of the expression pattern of GbVIP1 gene after cotton was inoculated with Verticillium dahliae

[0056] Cotton is grown by hydroponics, and the concentration of spores is 1*10 at the stage of two leaves and one heart 7 Cotton Verticillium dahliae Vd853 used the root dipping method to infect the roots of cotton seedlings, then respectively got the root tissue of 0h, 6h, 12h, and 24h cotton seedlings after inoculation, and utilized the method described in Example 1 to extract RNA and reverse It was transcribed into cDNA, and the expression of GbVIP1 gene after cotton was inoculated with Verticillium dahliae was studied by real-time PCR. See Example 1 for the primers and reaction system used. The results found that the expression level of GbVIP1 gene was up-regulated after inoculation, and the expression level of GbVIP1 gene was the highest at 6h after inoculation, which was 3.73 times that of the control ( ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a verticillium wilt resistant associated protein GbVIP1, a coding gene and application thereof. The amino acid sequence of the protein is shown as SEQ ID NO:1. The protein GbVIP1 provided by the invention comes from the verticillium wilt resistant gossypium barbadense variety Hai7124, belongs to the subfamily I of bZIP transcription factor family, and has a conservative bZIP structural domain. The study of the invention finds that the GbVIP1 gene has up-regulated expression under a verticillium dahlia infection condition, and silencing of the GbVIP1 gene lowers the resistance of gossypium barbadense to verticillium dahlia, therefore the GbVIP1 protein has important significance for verticillium wilt resistant breeding of cotton.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an anti-Verticillium wilt-related protein GbVIP1 and its coding gene and application. Background technique [0002] Verticillium wilt is the most serious disease in my country's cotton production. The three major cotton regions in my country's Northwest Inland, Yellow River Basin and Yangtze River Basin are harmed by Verticillium wilt to varying degrees every year, with an annual occurrence area of ​​about 3 million hm 2 , the annual economic loss is as high as 1.2 billion yuan (Zhu Heqin, Li Zhifang, Feng Zili, etc. Ten Years Review and Prospect of Cotton Verticillium Wilt Research in my country, Journal of Cotton Science, 2017, 29 (Supplement): 37-50). The long-term control practice of cotton Verticillium wilt shows that breeding and planting disease-resistant varieties is the most effective and economical measure to control cotton Verticillium wilt. However, my country's upland c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00A01H6/60
CPCC07K14/415C12N15/8282
Inventor王红梅赵佩赵云雷张凯陈伟龚海燕桑晓慧崔艳利
OwnerINST OF COTTON RES CHINESE ACAD OF AGRI SCI