Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for heterogenous expression of BAK1 protein

A protein, exogenous technology, applied in the field of genetic engineering, can solve the problems of unable to obtain protein, unable to meet demand, unable to obtain BAK1 protein, etc., to achieve the effect of high expression and correct conformation

Active Publication Date: 2019-03-01
BEE RES INST CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the BAK1 protein is a macromolecular eukaryotic extracellular secreted protein, exogenous expression of the BAK1 protein using a prokaryotic expression system often forms inclusion bodies, and the protein with the correct conformation cannot be obtained.
The existing technology adopts eukaryotic expression system to produce BAK1 protein, but cannot obtain BAK1 protein in the correct conformation
This is far from meeting the needs of the follow-up industry for BAK1 protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for heterogenous expression of BAK1 protein
  • Method for heterogenous expression of BAK1 protein
  • Method for heterogenous expression of BAK1 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Obtaining of BAK1 gene exons

[0041] Considering that the coding region of the BAK1 gene is discontinuous, the present invention uses the Arabidopsis cDNA as a template to amplify the BAK1 extracellular region gene. In the PCR amplification experiment, high-fidelity PCR enzymes were selected to prevent base mutations during the amplification process, and the primer sequences used were as follows.

[0042] BAK1_1_BamHI_5:

[0043] CGCGGATCCATGGAACGAAGATTAATGAT (SEQ ID NO. 4)

[0044] BAK1_220_6His_XhoI_3T:

[0045] CCGCTCGAGCTAATGATGATGATGATGATGACTCCCTGCAGGTGATGG (SEQ ID NO. 5)

[0046] PCR amplification reaction system: 5 μL 10×pfu buffer, 2.5 μL dNTP (2.5 mM), 0.5 μL each of 0.1 μM upstream and downstream primers, 1 μL pfu polymerase, 0.5 μL template, add double distilled water to 50 μL. The PCR amplification reaction conditions were 95°C, 5min; a total of 30 cycles: 94°C for 30s, 53°C for 30s, and 72°C for 600bp / min to calculate the required extension t...

Embodiment 2

[0048] Example 2 Exogenous expression vector pFastBac TM Construction of 1-6xHis

[0049] Signal peptides play an important role in protein expression and processing, usually exogenously expressing plant proteins such as BAK1 in insect cells. In terms of the selection of exogenous vectors, the inventors fully considered the selection principle of endonucleases and the signal transmission function of the signal peptide of the exogenous expression vector, because it is impossible to know whether the signal peptide of the plant protein itself can still function normally when transferred into insect cells For its own function, the present invention passes through the screening of enzyme cutting sites and attempts to introduce other signal peptides derived from baculovirus into the expression vector, and selects the sequence that can be recognized, cut and guided to pass through the endoplasmic reticulum membrane by the insect system as the secretion signal The purpose of the pept...

Embodiment 3

[0052] Example 3 BAK1 gene exons and exogenous expression vector pFastBac TM 1 Connection and preparation of recombinant bacmid

[0053] The choice of restriction endonucleases is based on the fact that the cut sequences of the two restriction endonucleases selected on both sides of the gene cannot appear in the target gene sequence, otherwise, in the later enzyme digestion experiment, the required The gene sequence connected into the vector will be cut by restriction endonucleases, so that a successful recombinant plasmid cannot be obtained. Based on the above principles, in this embodiment, two pairs of restriction endonucleases BamH1 and Xho1, Bgl2 and Sal1 were selected when screening enzyme cutting sites. BamH1 and Bgl2 are homologous to each other, and Xho1 and Sal1 are homologous to each other.

[0054] These two groups of homologous enzymes digest the target gene obtained in Example 1, and one of each group of homologous enzymes is selected, and used in pairs. There...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for heterogenous expression of BAK1 protein. The method comprises the following steps of performing digestion on the exon gene of a BAK1 extracellular domain with six His tags at the end C by BamH1 and Xhol; performing digestion on a pFastBac<TM>1 vector by BamH1 and Xhol; connecting products after the digestion; performing building to obtain a vector for heterogenous expression of BAK1 protein; transfecting an insect cell by the vector; after the cell is cultured, harvesting the cells and supernatant; performing chromatography and purification on the supernatant to obtain the BAK1 protein with the correct conformation. The expression quantity reaches 8.6 mg / L. The method overcomes the defect that in the prior art, the BAK1 protein with the correct conformation cannot be obtained by using a prokaryotic expression system, or when other eukaryotic expression systems are used, the BAK1 protein cannot be expressed. The expression quantity of the BAK1 proteinwith the correct conformation is improved; the cost is reduced.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for exogenously expressing BAK1 protein. Background technique [0002] Plant receptor kinases can be divided into many different receptor protein families according to the different extracellular recognition domains, among which the leucine-rich repeat receptor kinase (LRR- RK), the LRR-RK family is divided into 16 subfamilies. BAK1 protein belongs to the II family LRR-RK, 615 amino acids, widely expressed in plants, and its structural composition includes N-terminal signal peptide sequence, 5 LRRs, a serine / proline rich region, a single transmembrane domain and silk / Threonine kinase domain. [0003] BAK1 protein is a receptor protein kinase in the model plant Arabidopsis thaliana, which is located on the cell surface. The structure of the protein receptor kinase is divided into an extracellular recognition domain, a single transmembrane region and an intr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/866C12N9/12C12Q1/48
CPCC12N9/1205C12N15/86C12Q1/485C12Y207/01037G01N2333/91215C12N2710/14043C12N2800/105Y02A40/146
Inventor 汤娇孙亚东韩志富柴继杰石巍
Owner BEE RES INST CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More