Method for heterogenous expression of BAK1 protein
A protein, exogenous technology, applied in the field of genetic engineering, can solve the problems of unable to obtain protein, unable to meet demand, unable to obtain BAK1 protein, etc., to achieve the effect of high expression and correct conformation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Obtaining of BAK1 gene exons
[0041] Considering that the coding region of the BAK1 gene is discontinuous, the present invention uses the Arabidopsis cDNA as a template to amplify the BAK1 extracellular region gene. In the PCR amplification experiment, high-fidelity PCR enzymes were selected to prevent base mutations during the amplification process, and the primer sequences used were as follows.
[0042] BAK1_1_BamHI_5:
[0043] CGCGGATCCATGGAACGAAGATTAATGAT (SEQ ID NO. 4)
[0044] BAK1_220_6His_XhoI_3T:
[0045] CCGCTCGAGCTAATGATGATGATGATGATGACTCCCTGCAGGTGATGG (SEQ ID NO. 5)
[0046] PCR amplification reaction system: 5 μL 10×pfu buffer, 2.5 μL dNTP (2.5 mM), 0.5 μL each of 0.1 μM upstream and downstream primers, 1 μL pfu polymerase, 0.5 μL template, add double distilled water to 50 μL. The PCR amplification reaction conditions were 95°C, 5min; a total of 30 cycles: 94°C for 30s, 53°C for 30s, and 72°C for 600bp / min to calculate the required extension t...
Embodiment 2
[0048] Example 2 Exogenous expression vector pFastBac TM Construction of 1-6xHis
[0049] Signal peptides play an important role in protein expression and processing, usually exogenously expressing plant proteins such as BAK1 in insect cells. In terms of the selection of exogenous vectors, the inventors fully considered the selection principle of endonucleases and the signal transmission function of the signal peptide of the exogenous expression vector, because it is impossible to know whether the signal peptide of the plant protein itself can still function normally when transferred into insect cells For its own function, the present invention passes through the screening of enzyme cutting sites and attempts to introduce other signal peptides derived from baculovirus into the expression vector, and selects the sequence that can be recognized, cut and guided to pass through the endoplasmic reticulum membrane by the insect system as the secretion signal The purpose of the pept...
Embodiment 3
[0052] Example 3 BAK1 gene exons and exogenous expression vector pFastBac TM 1 Connection and preparation of recombinant bacmid
[0053] The choice of restriction endonucleases is based on the fact that the cut sequences of the two restriction endonucleases selected on both sides of the gene cannot appear in the target gene sequence, otherwise, in the later enzyme digestion experiment, the required The gene sequence connected into the vector will be cut by restriction endonucleases, so that a successful recombinant plasmid cannot be obtained. Based on the above principles, in this embodiment, two pairs of restriction endonucleases BamH1 and Xho1, Bgl2 and Sal1 were selected when screening enzyme cutting sites. BamH1 and Bgl2 are homologous to each other, and Xho1 and Sal1 are homologous to each other.
[0054] These two groups of homologous enzymes digest the target gene obtained in Example 1, and one of each group of homologous enzymes is selected, and used in pairs. There...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



