Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for exogenous expression of bak1 protein

A protein and exogenous technology, applied in the field of genetic engineering, can solve problems such as inability to obtain protein, inability to obtain BAK1 protein, and inability to meet demand, and achieve high expression levels

Active Publication Date: 2022-07-08
BEE RES INST CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the BAK1 protein is a macromolecular eukaryotic extracellular secreted protein, exogenous expression of the BAK1 protein using a prokaryotic expression system often forms inclusion bodies, and the protein with the correct conformation cannot be obtained.
The existing technology adopts eukaryotic expression system to produce BAK1 protein, but cannot obtain BAK1 protein in the correct conformation
This is far from meeting the needs of the follow-up industry for BAK1 protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for exogenous expression of bak1 protein
  • A method for exogenous expression of bak1 protein
  • A method for exogenous expression of bak1 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Acquisition of BAK1 gene exons

[0041] Considering that the coding region of the BAK1 gene is discontinuous, the present invention uses the Arabidopsis thaliana cDNA as a template to amplify the BAK1 extracellular region gene. PCR amplification experiments use high-fidelity PCR enzymes to prevent base mutations during the amplification process. The primer sequences used are as follows.

[0042] BAK1_1_BamHI_5:

[0043] CGCGGATCCATGGAACGAAGATTAATGAT (SEQ ID NO. 4)

[0044] BAK1_220_6His_XhoI_3T:

[0045] CCGCTCGAGCTAATGATGATGATGATGATGACTCCCTGCAGGTGATGG (SEQ ID NO. 5)

[0046] PCR amplification reaction system: 5 μL of 10×pfu buffer, 2.5 μL of dNTPs (2.5 mM), 0.5 μL of 0.1 μM upstream and downstream primers, 1 μL of pfu polymerase, 0.5 μL of template, and double distilled water to 50 μL. PCR amplification reaction conditions were 95 °C, 5 min; a total of 30 cycles: 94 °C for 30 s, 53 °C for 30 s, 72 °C for 600 bp / min to calculate the required extension time...

Embodiment 2

[0048] Example 2 Exogenous expression vector pFastBac TM 1-6xHis build

[0049] Signal peptides play an important role in protein expression and processing, usually exogenous expression of plant proteins such as BAK1 in insect cells. In terms of the selection of exogenous vectors, the inventors fully considered the selection principle of endonucleases and the signal transmission function of the signal peptide of the exogenous expression vector. Since it is impossible to know whether the signal peptide of the plant protein itself can still function normally when it is transferred into insect cells Its own function, the present invention selects the sequence that can be recognized, cleaved and guided to cross the endoplasmic reticulum membrane by the insect system as the secretion signal after the screening of the restriction site and the attempt to introduce other signal peptides derived from baculovirus into the expression vector. The purpose of the peptide is to increase the...

Embodiment 3

[0052] Example 3 BAK1 gene exon and exogenous expression vector pFastBac TM 1. Preparation of ligation and recombinant bacmid

[0053] The selection of restriction endonucleases is based on the fact that the two selected restriction endonuclease sequences on both sides of the gene cannot appear in the target gene sequence, otherwise, in the later process of enzyme digestion experiments, the The gene sequence ligated into the vector will be cleaved by restriction endonucleases, so that a successful recombinant plasmid cannot be obtained. Based on the above principles, two pairs of restriction endonucleases, BamH1 and Xho1, and Bgl2 and Sal1, were selected when screening the restriction endonuclease sites in this example. BamH1 and Bgl2 are mutually homologous enzymes, and Xho1 and Sal1 are mutually homologous enzymes.

[0054] The target gene obtained in Example 1 was digested by these two groups of isocatalyzed enzymes, and one isochromatic enzyme from each group was selecte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method for exogenously expressing BAK1 protein. The method comprises the steps of: cutting the exon gene of the extracellular domain of BAK1 with 6 His tags at the C-terminal end with BamH1 and Xho1, and cutting pFastBac with BamH1 and Xho1 TM 1. Vector, the products after the aforementioned enzyme digestion are connected to construct a vector for exogenous expression of BAK1 protein; the vector is transfected into insect cells, and after culturing the cells, the cells and supernatant are harvested, and the supernatant is purified by chromatography to obtain the correct conformation. The BAK1 protein was expressed at 8.6 mg / L. The method of the invention overcomes the disadvantage that the BAK1 protein in the correct conformation cannot be obtained by using the prokaryotic expression system or the BAK1 protein cannot be expressed by using other eukaryotic expression systems in the prior art, increases the expression amount of the BAK1 protein with the correct conformation, and saves the cost.

Description

technical field [0001] The present invention relates to the technical field of genetic engineering, in particular, to a method for exogenously expressing BAK1 protein. Background technique [0002] Plant receptor kinases can be divided into many different receptor protein families according to their extracellular recognition domains. Among them, leucine-rich repeatsreceptor kinases (LRR- RK), the LRR-RK family is divided into 16 subfamilies. BAK1 protein belongs to family II LRR-RK, 615 amino acids, widely expressed in plants, and its structural composition includes N-terminal signal peptide sequence, 5 LRRs, a serine / proline rich region, single transmembrane domain and silk / Threonine kinase domain. [0003] BAK1 protein is a receptor protein kinase in the model plant Arabidopsis thaliana, located on the cell surface. The structure of protein receptor kinase is divided into an extracellular recognition domain, a single-pass transmembrane domain and an intracellular kinase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/866C12N9/12C12Q1/48
CPCC12N9/1205C12N15/86C12Q1/485C12Y207/01037G01N2333/91215C12N2710/14043C12N2800/105Y02A40/146
Inventor 汤娇孙亚东韩志富柴继杰石巍
Owner BEE RES INST CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com