A quantitative method for carp spring viremia virus
A technology of carp spring viremia and virus, applied in the field of virus quantification, can solve the problems of increasing the occurrence of co-infection, decreasing the effect, and high equipment requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] [Example 1] Expansion and purification of carp spring viremia virus
[0092] 1.1 Expansion of SVCV virus
[0093] EPC cells were cultured in M199 medium with a concentration of 10% FBS at a constant temperature of 25°C and 5% CO. 2 . The day before the virus inoculation, the EPC cells were subcultured, and the cell concentration was adjusted appropriately so that the cell coverage rate was about 90% after the cells adhered to the wall of the culture flask the next day, and then the virus was inoculated. After adding the virus solution, shake the culture bottle gently to make the virus evenly dispersed and fully contact the cells, and then place it in a 25°C incubator to continue culturing. Observe the cells every day and take pictures. When 90% of the cells show cytopathic effect (CPE), the cell and virus mixture can be collected.
[0094] The collected cell and virus mixture was repeatedly frozen and thawed three times, and then filtered through a filter membrane wi...
Embodiment 2
[0098] [Example 2] Acquisition of the N gene sequence encoding carp spring viremia virus nucleoprotein
[0099] 2.1 Acquisition of nucleoprotein N nucleic acid sequence of carp spring viremia virus
[0100] Access to spring viraemia of carp virus on GenBank
[0101] The whole genome sequence of SVCV-265 strain, the accession number is KJ513477.1. The gene sequence encoding nucleoprotein N is obtained therefrom as follows (SEQ ID NO.1):
[0102]ATGAGTGTCATTCGGATCAAAACAAATGCTACAGTTGCTGCCGTGCTTCCGGCTAACGAAGATCAGGCCGATTATCCTTCCACTTTTTTTGAAGGGGGGAATGAGATTAGATTGTATGTTAACAGGGGGGAGAAATTGGATGTTTTAAGGCAATATGTCTATATGGGACTGGTGGAGAAAAACTGTAGGATACAGCATGTGAATGCTTATCTATATGCTGTGCTGAAGGGAGAAAGAGAGCTGCTAGAAGCGGATTGGGATAGCTTTGGGCACAAGATTGGGATTCAGGGGGATAAGATCGGGCCTTTTAACTTGGTGCGAGTGGAAGACATCCCCGACGGGTTACCAGATGGGAAACTGAATGCAGAGGTGAGTGCTGAGGATGATGCATGGCTGCCTCTCTTCTTGCTGGGTCTTTACAGAGTGGGAAGGGCAAGTGAGACTGCATACCGGACTTTGCTGATGGAGTCCCTGATAAAACAGTGTAAGGCAATAAAATCTGACTGGGTGTCTCCTGTAACGGCAACTCACAAATATTTCGA...
Embodiment 3
[0107] [Example 3] Recombinant plasmid pMD TM Construction of 18-T-SVCV-N
[0108] 3.1 Reverse transcription to obtain the cDNA of virus SVCV
[0109] Use the SVCV virus stock solution obtained in the laboratory as the RNA template, and use Takara's reverse transcription kit PrimeScript TM RT-PCR Kit for RT-PCR.
[0110] 1) template RNA denaturation and reverse transcription reaction
[0111] Use a clean RNase-free PCR tube to prepare the reaction mixture according to the following table:
[0112]
[0113] 2) Carry out denaturation and annealing reactions on the PCR instrument according to the following procedures
[0114] 65℃5min
[0115] 4°C
[0116] 3) Prepare the following reverse transcription reaction solution in the above reaction tube
[0117]
[0118] 4) Carry out the reverse transcription reaction on the PCR instrument according to the following conditions:
[0119] 30℃10min
[0120] 42℃30min
[0121] 95℃5min
[0122] 4°C
[0123] 3.2PCR reaction am...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


