Unlock instant, AI-driven research and patent intelligence for your innovation.

A quantitative method for carp spring viremia virus

A technology of carp spring viremia and virus, applied in the field of virus quantification, can solve the problems of increasing the occurrence of co-infection, decreasing the effect, and high equipment requirements

Active Publication Date: 2021-10-01
SHENZHEN UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] (1) A support film with good hydrophilicity must be used to make the sample structure and dyeing effect consistent, thereby ensuring the accuracy of quantitative analysis. It is difficult for ordinary copper mesh to meet the sample preparation requirements. The newly prepared carbon-Formvar (Formvar Or Collodion, Butvar and Pioloform and other substitutes) the copper mesh support film can ensure the uniform distribution of the adsorbed particles, but the effect will decrease significantly as the storage time prolongs;
[0010] (2) In the process of negative staining sample preparation, the degree of affinity between virus particles and the support membrane or dye will affect the quantity of adsorbed virus particles, the overall appearance of the virus structure and the change of osmotic pressure, which will affect the quantification;
[0011] (3) High equipment requirements;
[0012] (4) The sample preparation operation is relatively complicated, and requires a high level of operation for the experimenter
[0015] (1) The basis of the quantitative method of plaque formation test is that one infectious particle can form a plaque, but there is a possibility that multiple infectious particles can form a plaque at the same time, thus affecting the accuracy of quantification
A researcher mixed 10 kinds of gene-marked polioviruses (polioviruses) and conducted a plaque experiment. Among the 123 plaques formed, 6 plaques contained more than one virus. The study also found that low pH can lead to virus Aggregation of particles, which increases the probability of co-infection;
[0016] (2) The quantitative method of plaque formation test takes a long time. From the preparation of cells, virus inoculation, to the appearance of plaques, the whole process takes 3 days or more
[0024] In summary, the TaqMan probe method qPCR has the advantages of good specificity, high sensitivity, and good reproducibility. It is a relatively good method in the quantitative detection of viruses including SVCV, but due to its high cost , higher requirements for experimental technology and equipment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A quantitative method for carp spring viremia virus
  • A quantitative method for carp spring viremia virus
  • A quantitative method for carp spring viremia virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] [Example 1] Expansion and purification of carp spring viremia virus

[0092] 1.1 Expansion of SVCV virus

[0093] EPC cells were cultured in M199 medium with a concentration of 10% FBS at a constant temperature of 25°C and 5% CO. 2 . The day before the virus inoculation, the EPC cells were subcultured, and the cell concentration was adjusted appropriately so that the cell coverage rate was about 90% after the cells adhered to the wall of the culture flask the next day, and then the virus was inoculated. After adding the virus solution, shake the culture bottle gently to make the virus evenly dispersed and fully contact the cells, and then place it in a 25°C incubator to continue culturing. Observe the cells every day and take pictures. When 90% of the cells show cytopathic effect (CPE), the cell and virus mixture can be collected.

[0094] The collected cell and virus mixture was repeatedly frozen and thawed three times, and then filtered through a filter membrane wi...

Embodiment 2

[0098] [Example 2] Acquisition of the N gene sequence encoding carp spring viremia virus nucleoprotein

[0099] 2.1 Acquisition of nucleoprotein N nucleic acid sequence of carp spring viremia virus

[0100] Access to spring viraemia of carp virus on GenBank

[0101] The whole genome sequence of SVCV-265 strain, the accession number is KJ513477.1. The gene sequence encoding nucleoprotein N is obtained therefrom as follows (SEQ ID NO.1):

[0102]ATGAGTGTCATTCGGATCAAAACAAATGCTACAGTTGCTGCCGTGCTTCCGGCTAACGAAGATCAGGCCGATTATCCTTCCACTTTTTTTGAAGGGGGGAATGAGATTAGATTGTATGTTAACAGGGGGGAGAAATTGGATGTTTTAAGGCAATATGTCTATATGGGACTGGTGGAGAAAAACTGTAGGATACAGCATGTGAATGCTTATCTATATGCTGTGCTGAAGGGAGAAAGAGAGCTGCTAGAAGCGGATTGGGATAGCTTTGGGCACAAGATTGGGATTCAGGGGGATAAGATCGGGCCTTTTAACTTGGTGCGAGTGGAAGACATCCCCGACGGGTTACCAGATGGGAAACTGAATGCAGAGGTGAGTGCTGAGGATGATGCATGGCTGCCTCTCTTCTTGCTGGGTCTTTACAGAGTGGGAAGGGCAAGTGAGACTGCATACCGGACTTTGCTGATGGAGTCCCTGATAAAACAGTGTAAGGCAATAAAATCTGACTGGGTGTCTCCTGTAACGGCAACTCACAAATATTTCGA...

Embodiment 3

[0107] [Example 3] Recombinant plasmid pMD TM Construction of 18-T-SVCV-N

[0108] 3.1 Reverse transcription to obtain the cDNA of virus SVCV

[0109] Use the SVCV virus stock solution obtained in the laboratory as the RNA template, and use Takara's reverse transcription kit PrimeScript TM RT-PCR Kit for RT-PCR.

[0110] 1) template RNA denaturation and reverse transcription reaction

[0111] Use a clean RNase-free PCR tube to prepare the reaction mixture according to the following table:

[0112]

[0113] 2) Carry out denaturation and annealing reactions on the PCR instrument according to the following procedures

[0114] 65℃5min

[0115] 4°C

[0116] 3) Prepare the following reverse transcription reaction solution in the above reaction tube

[0117]

[0118] 4) Carry out the reverse transcription reaction on the PCR instrument according to the following conditions:

[0119] 30℃10min

[0120] 42℃30min

[0121] 95℃5min

[0122] 4°C

[0123] 3.2PCR reaction am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention amplifies the nucleoprotein gene N of SVCV through molecular biology techniques, and constructs recombinant plasmid pMD TM 18‑T‑SVCV‑N, using this plasmid as a template to establish an absolute quantitative SVCV copy number method based on the TaqMan probe method qPCR as a standard curve. At the same time, the protein concentration of SVCV was measured by Bradford method, and the correlation with the copy number of SVCV measured by the qPCR method was established. For the first time, a method for directly measuring protein concentration to determine the copy number of SVCV was established. This method can realize the simple and low-cost determination of the copy number of SVCV, and at the same time has important reference significance for the quantification of other viruses, and has important value in the related research of SVCV and other viruses.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a virus quantification method. Background technique [0002] Spring Viraemia of Carp (SVC for short) is a highly contagious epidemic disease of carps. The pathogen of the disease is Spring Viremia of Carp Virus (SVCV). SVCV causes the mortality rate of fish to be as high as more than 90%, which poses a great threat to the healthy breeding of freshwater fish. The Ministry of Agriculture promulgates "One, Two, and Three Types of Animal Epidemic Disease List (Aquatic Animal Epidemic Part)" (People's Republic of China Announcement of the Ministry of Agriculture, No. 1125) it is listed as a class of animal diseases. Moreover, the World Organization for Animal Health has also included it in the list of aquatic animal diseases (OIE, 2009, CHAPTER 2.3.8). In terms of its infectivity, it can be called "bird flu in aquatic animals" (this disease is listed as a class of animal diseases with b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6851G01N33/68
CPCC12Q1/6851G01N33/68C12Q2561/113C12Q2563/107C12Q2545/114C12Q2561/101C12Q2531/113
Inventor 邓利香凤谭景云兰文升
Owner SHENZHEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More