Tumor homing cell-penetrating peptide tLyP-1 modified apoferritin nano-cage and preparation method thereof

A technology of apoferritin and tlyp-1, applied in the field of biomedicine, can solve the problem of single targeting, achieve the effect of reducing dosage and improving therapeutic effect

Inactive Publication Date: 2019-03-19
NANJING FORESTRY UNIV
View PDF9 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a tumor-homing penetrating peptide in order to overcome the single or insufficient targeting of natural artificial apoferritin as a nano-drug carrier for the diagnosis and treatment of glioma, breast cancer and other malignant tumor cells tLyP-1 modified apoferritin, the ferritin can not only achieve targeted delivery of drugs to tumor cells, but also to tumor neovascularization, and is expected to pass through the blood-brain barrier to achieve targeted diagnosis and treatment of glioma, breast cancer, etc. The effect of cancer and other malignant tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor homing cell-penetrating peptide tLyP-1 modified apoferritin nano-cage and preparation method thereof
  • Tumor homing cell-penetrating peptide tLyP-1 modified apoferritin nano-cage and preparation method thereof
  • Tumor homing cell-penetrating peptide tLyP-1 modified apoferritin nano-cage and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0033] The preparation method of the apoferritin nanocage modified by the tumor-homing penetrating peptide tLyP-1 of the present invention comprises the following steps:

[0034] (1) Construction of recombinant protein cage expression engineering bacteria

[0035] Based on the HFtn coding gene, modify the coding gene TGTGGTAATAAACGTACCCGTGGTGGTGGTGGTAGC at the 5' end of the tumor-homing membrane-penetrating peptide tLyP-1 and the connecting peptide GGGGS, and subclone the gene sequence into the pET-20b(+) plasmid vector to obtain A plasmid containing the gene of interest. The plasmid was heat-shocked into Escherichia coli competent cells, and positive single clones were selected by means of ampicillin resistance and gene sequencing, etc., and the positive single clones were cultured in large quantities, and the recombinant bacteria were preserved in 10% glycerol. (2) Expression of recombinant protein and collection of strains

[0036] Inoculate the engineered bacteria expres...

Embodiment 1

[0041] Such as figure 1 As shown in Figure 4, the construction of pET-20b(+) / tLyP-1-HFtn expressing recombinant engineering bacteria

[0042] Add the TGTGGTAATAAACGTACCCGTGGTGGTGGTGGTAGC sequence at the 5' end of the HFtn gene coding sequence reported in the literature,

Embodiment 2

[0044] Analysis of the soluble expression form of tLyP-1-HFtn target recombinant protein

[0045] Add the positive recombinant bacteria to the LB medium containing ampicillin, shake at 37°C and 200r / min overnight to activate the strain. Transfer 1% of the inoculum to 5 mL of LB medium containing ampicillin, culture at 37°C and 210 r / min until the OD600 of the bacterial solution reaches 0.6-0.8, add IPTG with a final concentration of 0.5mM to the medium, and induce at 30°C Cultivate for 6h. Take 2mL of bacterial liquid, centrifuge at 4°C, 8000×g for 5min to collect the bacterial cells, discard the supernatant, add 200μL of binding buffer (50mM NaH2PO4, 300mM NaCl, 10Mm imidazole, pH=7.9) to resuspend, under the same conditions Centrifuge again, discard the supernatant to collect the bacteria, resuspend in 200 μL of binding buffer again, and store at 4°C. The bacteria were ultrasonically disrupted, and the sample was taken out as the total bacteria; the supernatant was collect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tumor homing cell-penetrating peptide tLyP-1 modified apoferritin nano-cage and a preparation method thereof. The protein nano-cage is hollow cage-shaped protein formed by self-assembling 24 protein subunits; and one tumor homing cell-penetrating peptide tLyP-1 is modified on an N end of each protein subunit by utilizing a gene recombination technology to obtain a recombinant human body heavy-chain ferritin nano-cage with a tLyP-1 modified surface. According to the protein nano-cage provided by the invention, a medicine is loaded into the nano-cage through adjusting depolymerization and recombination of the protein subunits; the nano-cage has good water solubility and biocompatibility, has excellent stability in a human body and has a uniform size; the nano-cage can be specifically combined with a lot of neuropilin receptors 1 (NRP-1) which are expressed in tumor neovascularization and tumor cells of malignant tumors including gliomas, breast cancer, pancreatic cancer, gastric cancer, colorectal cancer, non-small cell lung cancer and the like; and types of the tumors treated by the nano-cage are greatly increased and the targeting ability of tumor treatment is improved. The protein nano-cage provided by the invention has an extremely great application prospect in the aspects of tumor diagnosis and treatment and the like.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a recombinant apoferritin nanocage modified with tumor-homing penetrating peptide tLyP-1 and a preparation method thereof. Background technique [0002] The most commonly used method to treat malignant tumors is chemotherapy, but because most chemotherapy drugs lack targeting selectivity and cause serious damage to the patient's normal tissues and organs, the realization of targeted chemical drug diagnosis and treatment is the main goal of cancer treatment at present. Target. Apoferritin is self-assembled by 24 subunits to form a spherical cage structure with an inner diameter of 8nm and an outer diameter of 12nm. The protein can depolymerize and recombine the subunits by adjusting the pH, using different concentrations of urea, etc., so that the drug can be loaded into the nanocage; the nanocage has good water solubility, good biocompatibility, good stability, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/70C07K14/47C07K1/22C07K1/16
CPCC12N15/70C07K14/47
Inventor张瑜李瑞珂马原蒙赵竹君王飞李迅
OwnerNANJING FORESTRY UNIV