Method for inducing human epidermal stem cells into corneal epithelial cells
A technology of corneal epithelial cells and epidermal stem cells, applied in the direction of epidermal cells/skin cells, non-embryonic pluripotent stem cells, artificially induced pluripotent cells, etc., can solve the problems of speed and success rate to be improved, and achieve high-efficiency induction effect, Effect of improving differentiation efficiency and increasing activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Separation of Human Epidermal Stem Cells
[0039] Conventional methods for isolating epidermal stem cells in the art are used for isolation, or commercially purchased epidermal stem cells can be used for direct culture.
[0040] Specifically, the method for obtaining one of the epidermal stem cells shown in the present invention is as follows:
[0041] The foreskin skin of healthy men after circumcision was taken to prepare epidermal cells and fibroblasts.
[0042] 1. Separation of epidermal cells: take 2cm long and 2mm wide skin, wash 3 times with PBS containing antibiotics; put in protease solution, digest at 4°C for 16 hours; take out the skin, peel off the epidermis and dermis; collect epidermal slices , placed in 0.25% trypsin / 0.02% EDTA (1:1) mixture, digested at 37°C for 15 minutes, terminated the digestion, filtered after a little pipetting, collected the cell suspension, discarded the supernatant by centrifugation, added fresh culture medium, and re-...
Embodiment 2
[0047] Embodiment 2 Transgenic preparation of human epidermal stem cells
[0048] First, according to the EEFSEC gene, the upstream and downstream primers were designed. The specific primers are as follows (the restriction sites Ncol and Hindlll are respectively added to the upstream and downstream of the primers): F1: atggcagggcggcgggtgaa (SEQ ID NO: 2); R1: tcagggagactgaaccatgc (SEQ ID NO: 3). Using human genomic DNA as a template and using F1 and R1 as primers for PCR amplification, the amplification system and conditions are as follows:
[0049] PCR reaction system: dNTP with a final concentration of 250 μM, 10 mM Tris-Cl, pH8.0, 50 mM KCl, 1.5 mM MgCl2, 2 pM upstream primer, 2 pM downstream primer, 2 μl DNA, IU Taq DNA polymerase, supplemented to 20 μl with ddH20;
[0050] PCR reaction conditions: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30s, 62.5°C renaturation for 35s, 72°C extension for 35s, 40 cycles, then 72°C extension for 10 minutes, and finally ...
Embodiment 3
[0055] Example 3 Induction of human epidermal stem cells to corneal epithelial cells
[0056] Take human epidermal stem cells and the transgenic human epidermal stem cells obtained in Example 2 to carry out cell climbing in 6-well plates respectively, and the cell planting density is controlled at 6×10 4 piece / cm 2The DMEM / F12 culture solution was fed statically at 30 degrees Celsius for 3 days. Replace with corneal epithelial cell culture medium, culture and incubate in an incubator at 25 degrees Celsius, change half of the medium every 2 days, induce low temperature, and culture for 5 days. The composition of corneal epithelial cell culture medium (without corneal promoting peptide) is: add 1mL 100X CEpiCGS (Corneal Epithelial Cell Growth Supplement) corneal epithelial cell growth supplement 5ml (ScienCell) to every 100mL corneal cell culture medium (ScienCell), 5pg / mL BSA, 1pg / mL insulin, 25ng / mL FGF, 500ng / mL epinephrine, 0.5μg / mL hydrocortisone, 0.5nmol / L prostaglandin ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



