Supercharge Your Innovation With Domain-Expert AI Agents!

Method for inducing human epidermal stem cells into corneal epithelial cells

A technology of corneal epithelial cells and epidermal stem cells, applied in the direction of epidermal cells/skin cells, non-embryonic pluripotent stem cells, artificially induced pluripotent cells, etc., can solve the problems of speed and success rate to be improved, and achieve high-efficiency induction effect, Effect of improving differentiation efficiency and increasing activity

Active Publication Date: 2020-10-16
RAFAEL (SHENZHEN) INVESTMENT CONSULTING CO LTD
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0018] Although the above methods can be converted into corneal cells, the speed of conversion and the success rate of conversion need to be improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inducing human epidermal stem cells into corneal epithelial cells
  • Method for inducing human epidermal stem cells into corneal epithelial cells
  • Method for inducing human epidermal stem cells into corneal epithelial cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Separation of Human Epidermal Stem Cells

[0039] Conventional methods for isolating epidermal stem cells in the art are used for isolation, or commercially purchased epidermal stem cells can be used for direct culture.

[0040] Specifically, the method for obtaining one of the epidermal stem cells shown in the present invention is as follows:

[0041] The foreskin skin of healthy men after circumcision was taken to prepare epidermal cells and fibroblasts.

[0042] 1. Separation of epidermal cells: take 2cm long and 2mm wide skin, wash 3 times with PBS containing antibiotics; put in protease solution, digest at 4°C for 16 hours; take out the skin, peel off the epidermis and dermis; collect epidermal slices , placed in 0.25% trypsin / 0.02% EDTA (1:1) mixture, digested at 37°C for 15 minutes, terminated the digestion, filtered after a little pipetting, collected the cell suspension, discarded the supernatant by centrifugation, added fresh culture medium, and re-...

Embodiment 2

[0047] Embodiment 2 Transgenic preparation of human epidermal stem cells

[0048] First, according to the EEFSEC gene, the upstream and downstream primers were designed. The specific primers are as follows (the restriction sites Ncol and Hindlll are respectively added to the upstream and downstream of the primers): F1: atggcagggcggcgggtgaa (SEQ ID NO: 2); R1: tcagggagactgaaccatgc (SEQ ID NO: 3). Using human genomic DNA as a template and using F1 and R1 as primers for PCR amplification, the amplification system and conditions are as follows:

[0049] PCR reaction system: dNTP with a final concentration of 250 μM, 10 mM Tris-Cl, pH8.0, 50 mM KCl, 1.5 mM MgCl2, 2 pM upstream primer, 2 pM downstream primer, 2 μl DNA, IU Taq DNA polymerase, supplemented to 20 μl with ddH20;

[0050] PCR reaction conditions: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30s, 62.5°C renaturation for 35s, 72°C extension for 35s, 40 cycles, then 72°C extension for 10 minutes, and finally ...

Embodiment 3

[0055] Example 3 Induction of human epidermal stem cells to corneal epithelial cells

[0056] Take human epidermal stem cells and the transgenic human epidermal stem cells obtained in Example 2 to carry out cell climbing in 6-well plates respectively, and the cell planting density is controlled at 6×10 4 piece / cm 2The DMEM / F12 culture solution was fed statically at 30 degrees Celsius for 3 days. Replace with corneal epithelial cell culture medium, culture and incubate in an incubator at 25 degrees Celsius, change half of the medium every 2 days, induce low temperature, and culture for 5 days. The composition of corneal epithelial cell culture medium (without corneal promoting peptide) is: add 1mL 100X CEpiCGS (Corneal Epithelial Cell Growth Supplement) corneal epithelial cell growth supplement 5ml (ScienCell) to every 100mL corneal cell culture medium (ScienCell), 5pg / mL BSA, 1pg / mL insulin, 25ng / mL FGF, 500ng / mL epinephrine, 0.5μg / mL hydrocortisone, 0.5nmol / L prostaglandin ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for inducing human epidermal stem cells into corneal epithelioid cell differentiation in vitro. A specific cornea promoting peptide is used, so that the differentiationefficiency of the cornea epithelial cells can be obviously improved.

Description

technical field [0001] The invention relates to a method for inducing human epidermal stem cells into corneal epithelial cells. Background technique [0002] Stem cells, cells of origin, are cells with proliferation and differentiation potential, the ability to self-renew and replicate, and can produce highly differentiated functional cells. Simply put, it is a type of primitive undifferentiated cell with multi-directional differentiation potential and self-replication ability, and is the original cell that forms various tissues and organs of mammals. In addition, stem cells have the potential to regenerate various tissues and organs, so they are also called "universal cells" in the medical field. It is precisely because of this characteristic of stem cells that it has become the basis of regenerative medicine in the 21st century, and it has become the frontier and hot spot of current technology. [0003] Stem cell research is one of the most dynamic, influential and promi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N5/079C12N5/074
CPCC07K14/47C12N2501/02C12N2501/115C12N2501/30C12N2501/33C12N2501/39C12N2501/81C12N2501/999C12N2506/09
Inventor 杨骏余兵生
Owner RAFAEL (SHENZHEN) INVESTMENT CONSULTING CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More