Separated recombinant oncolytic adenovirus, drug composition and application of separated recombinant oncolytic adenovirus to drug for treating tumor and/or cancer

An oncolytic adenovirus and composition technology, applied in the biological field, can solve the problems of T cell anergy or specific immune tolerance and apoptosis, and achieve enhanced anti-tumor immune stimulation, improved safety, and low toxicity Effect

Active Publication Date: 2019-04-05
BEIJING CONVERD CO LTD
View PDF5 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the absence of the second signal provided by co-stimulatory molecules, it will lead to anergy or specific immune tolerance of T cells and even apoptosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Separated recombinant oncolytic adenovirus, drug composition and application of separated recombinant oncolytic adenovirus to drug for treating tumor and/or cancer
  • Separated recombinant oncolytic adenovirus, drug composition and application of separated recombinant oncolytic adenovirus to drug for treating tumor and/or cancer
  • Separated recombinant oncolytic adenovirus, drug composition and application of separated recombinant oncolytic adenovirus to drug for treating tumor and/or cancer

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0110] Preparation Example 1: Construction of E1A Gene Expression Vector

[0111] According to the human adenovirus type 5 (AD5) genome DNA sequence (ACCESSION: AC_000008) in the Genbank of NCBI (that is, the National Center for Biotechnology Information, website: https: / / www.ncbi.nlm.nih.gov) design two PCR primers (P1: GGA AGATCTGGACTGAAAATGAG (SEQ ID No.1), P2: TGAGGTCAGATGTAACCAAGATTA (SEQ ID No.2); note: the 5' end of the primer P1 has added a BglII restriction site, underlined); extracted from Shanghai Sanwei Biotechnology Co., Ltd. Oncolytic virus (H101) genomic DNA was used as a template for high-fidelity PCR amplification of the 1164bp sequence between 551-1714 on the AD5 genomic DNA, and the actual size was 1173bp (see figure 1 ), this sequence includes the coding region of the E1A gene (excluding the E1A promoter sequence) and part of the 3'UTR region. Utilize the PCR product that BglII digestion obtains, and it is cloned between the BglII and the EcoRV site in t...

preparation example 2

[0114] Preparation example 2: construction of shRNA expression vector

[0115] According to the human PDL1variant1 sequence (ACCESSION: NM_014143) in Genbank on the NCBI website, three shRNA sequences (shPDL1-1 (or shPDL1-#1), shPDL1-2 (or shPDL1-#2) and shPDL1-3 (or shPDL1-#3), respectively SEQ ID NO.16, SEQ ID NO.19, SEQ ID NO.22) In addition, a negative control sequence shPDL1-NC that has nothing to do with human PDL1 mRNA was also designed. The sequence is as follows:

[0116] (1) shPDL1-1

[0117] Synthetic sense sequence (SEQ ID No.14):

[0118] 5'-CACC GGGAAATGGAGGATAAGAACA TGTTTCTTATCCTCCATTTCCC -3'

[0119] Synthetic antisense sequence (SEQ ID No.15):

[0120] 5'-AGCT GGGAAATGGAGGATAAGAACA TGTTCTTATCCTCCATTTCC C- 3'

[0121] shRNA DNA (SEQ ID No.16):

[0122] GGGAAATGGAGGATAAGAACA TGTTTCTTATCCTCCATTTCCC

[0123] (2) shPDL1-2

[0124] Synthetic sense sequence (SEQ ID No.17):

[0125] 5'-CACC GGATCCAGTCACCTCTGAACA TGTTCAGAGGTGAC...

preparation example 3

[0147] Preparation Example 3: Preparation of Genomic DNA of Oncolytic Adenovirus (OAd-shPDL1)

[0148] 1. After confirming the inhibitory effect of shPDL1, clone the coding frame including the U6 promoter and the entire sequence of shPDL1 into pShuttle-MCS-E1A. First, use SacI to digest the pSGU6 / GFP / Neo-shPDL1 vector, then use T4 DNA polymerase to cut the sticky ends formed after SacI digestion, and then carry out ethanol / ammonium acetate precipitation and recovery, and finally digest with KpnI and recover including Coding frame sequence including the U6 promoter and shPDL1 sequence; at the same time, the pShuttle-MCS-E1A vector was digested with KpnI and EcoRV and recovered, and finally the three shPDL1 coding frames were respectively connected to the pShuttle-MCS-E1A vector to obtain the final Vector pShuttle-U6-shPDL1-CMV-E1A, see the procedure Figure 10 . Select a few colonies to extract the plasmid and carry out KpnI / HindIII enzyme digestion identification, and the co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a separated recombinant oncolytic adenovirus, a drug composition and application of the separated recombinant oncolytic adenovirus to a drug for treating tumor and / or cancer. The recombinant oncolytic adenovirus is a selective replication type oncolytic adenovirus, and a genome of the recombinant oncolytic adenovirus is integrated with a coded sequence of exogenous shRNA capable of inhibiting PDL1 expression in tumor cells. The replication ability of the separated recombinant oncolytic adenovirus in normal primary cells is far lower than that of the separated recombinantoncolytic adenovirus in the tumor cells, the high-expression PDL1 protein level in the tumor cells can be significantly lowered by expressed shPDL1, and thus the oncolytic killing effect of an oncolytic virus and the antitumor immunostimulation effect of T lymphocyte achieve a synergetic effect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an isolated recombinant oncolytic adenovirus, a pharmaceutical composition and its use in drugs for treating tumors and / or cancers. Background technique [0002] According to the latest report on the cause of population death published on the website of the World Health Organization in January 2013, about 7.6 million people died of cancer in the world in 2008, accounting for 13% of the total number of deaths in the world, and this number is still growing rapidly every year. In 2030, this number will exceed 13.1 million. In my country, the incidence of malignant tumors is increasing at an average annual rate of 3% to 5%. In 2002, there were 2.19 million new cases of malignant tumors in the country every year. By 2020, the number of new cases will exceed 3 million. Cancer has become one of the leading causes of death in the world. Moreover, the treatment of tumors has bec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C12N15/861A61P35/00A61P35/02
CPCA61K35/17A61K35/761C12N7/00C12N15/1138C12N15/86C12N2710/10043C12N2710/10021C12N2310/10C12N2310/531A61K2300/00A61P35/00A61P35/02C12N2320/32C12N2330/51C12N2310/14C12N2710/10343C12N2710/10332C12N15/113C12N15/63A61K48/005C12N15/1135C12N15/64
Inventor傅瑾绳纪坡赵荣华秦云陈霖康三毛胡放
OwnerBEIJING CONVERD CO LTD