Soybean low phosphorus response genes capable of promoting formation of lateral roots and protein and application of soybean low phosphorus response genes

A technology of protein and gene, which is applied in soybean low-phosphorus-responsive gene and its protein and application field to promote the formation of lateral roots, can solve problems such as unclearness and soybean adaptability to low-phosphorus stress, and achieve the effect of great commercial value

Active Publication Date: 2019-04-12
SOUTH CHINA AGRI UNIV
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there has been some research on soybean, but it is still unclear about the mechanism by which soybean adapts to low phosphorus stress and changes root system configuration and morphology, and whether NF-YA transcriptional regulators are involved in related regulatory processes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean low phosphorus response genes capable of promoting formation of lateral roots and protein and application of soybean low phosphorus response genes
  • Soybean low phosphorus response genes capable of promoting formation of lateral roots and protein and application of soybean low phosphorus response genes
  • Soybean low phosphorus response genes capable of promoting formation of lateral roots and protein and application of soybean low phosphorus response genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 GmNFYA7 gene quantitative experiment

[0034] 1. Experimental method

[0035] 1. Quantitative PCR primer design

[0036] Download GmNFYA7 genome sequence (nucleotide sequence as shown in SEQ ID NO: 1), GmNFYA7 transcript sequence (nucleotide sequence as shown in SEQ ID NO: 2), GmNFYA7 CDS sequence (nucleotide sequence as shown in SEQ ID NO: 2) from website download NO: 3), GmNF-YA7 protein sequence (amino acid sequence is shown in SEQ ID NO: 4).

[0037] Design its specific quantitative amplification primers:

[0038] GmNFYA7.qF: CATGACCTCTCAGATAATGAAGC;

[0039] GmNFYA7.qR: TGCAAGTATGGCTTCCGAT.

[0040] 2. Planting of soybean materials and treatment of phosphorus deficiency

[0041] a. Seed disinfection

[0042] Mature, plump soybean seeds are arranged in a single layer in a Petri dish, placed in a desiccator, and the Petri dish is opened with the lid next to the Petri dish. Add 100ml of sodium hypochlorite to a 250ml beaker in a desiccator, then slowly ...

Embodiment 2

[0062] Embodiment 2 GmNFYA7 gene overexpression vector construction (gateway method)

[0063] 1. Experimental method

[0064] 1. Primer design

[0065] Download the GmNFYA7 gene CDS sequence (nucleotide sequence as shown in SEQ ID NO: 3) from the website, design its specific amplification primers,

[0066] OE-GmNFYA7.F:

[0067] gggacaagtttgtacaaaaaagcaggcttcTCATGTGTGTAGATTGGGACACTG;

[0068] OE-GmNFYA7.R:

[0069] ggggaccactttgtacaagaaagctgggtcCTTAGGATGTTCTATCTGATGGTGC.

[0070] 2. Fragment amplification and purification

[0071] Using the cDNA of soybean YCO3-3 as a template, use the specific primers of OE-GmNFYA7 to amplify the corresponding fragment. The reaction system and reaction conditions are shown in Table 3 and Table 4 below; run the PCR reaction product on agarose gel electrophoresis, and match the position The bright band was excised and recovered, and then the PCR product was recovered using an agarose gel DNA recovery kit to obtain the target fragment.

...

Embodiment 3

[0087] Embodiment 3 Arabidopsis genetic transformation

[0088] 1. Experimental method

[0089] 1. Planting of wild-type Arabidopsis (Col-0)

[0090] Sow the wild-type Arabidopsis seeds (Col-0) evenly on the surface of the nutrient pot with the substrate, spray some water, then cover it with a plastic film to keep it moist, and put it in the dark at 4°C for 2 to 3 days to break it. Seed dormancy.

[0091] Then placed in an artificial climate chamber (16 hours of light at 24°C / 8 hours of darkness at 24°C) for cultivation, waited for a week, and then transplanted into nutrient pots respectively, with 3 to 4 plants in each pot, when the first bolting 1cm , cut off the main stem to increase the number of branches, and when Arabidopsis blooms next time, it can be transformed with Agrobacterium liquid.

[0092] 2. Transformation of Arabidopsis flocs with Agrobacterium liquid

[0093] The Agrobacterium GV3101 preservation solution carrying the target vector (the GmNFYA7 gene over...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses soybean low phosphorus response genes NFYA7 capable of promoting formation of lateral roots and protein and application of the soybean low phosphorus response genes NFYA7. Theamino acid sequence of GmNFYA7 protein is as shown in SEQID NO:4, and the nucleotide sequence of GmNFYA7 genes is as shown in SEQID NO:1, SEQID NO:2 or SEQID NO:3. The soybean low phosphorus responsegenes provides a theoretical basis for leguminous crops including soybeans, and even dicotyledonous plants on a mechanism that NF-YA regulating factors participate in plant response low phosphorus stress and change root system configuration and shape. Besides, the invention provides an effective method for plants which are adapted to low phosphorus stress through changing root system configurationand shape, and the method brings high commercial value to crops, and is worth of promotion and application.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a soybean low phosphorus response gene for promoting lateral root formation, its protein and its application. Background technique [0002] The root system is the key for terrestrial plants to fix and effectively absorb water and mineral nutrients in the soil, and plays a vital role in plant adaptation to various adversity stresses. Root system architecture (RSA), the overall spatial arrangement of the various parts of the root system, is an important factor in determining how efficiently plants acquire resources. Plant productivity is greatly affected by root structural traits, which are important targets for agricultural improvement. Changes in the structural characteristics of the root system can alter the plant root's exposure to different layers in heterogeneous soils, allowing the plant to absorb more nutrients and water efficiently. That's because resources l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/06A01H6/20
CPCC12N15/8261C12N15/8271C07K14/415
Inventor王金祥何平安许志豪欧斯艳
OwnerSOUTH CHINA AGRI UNIV