Method for editing grape ZEP gene fixed point based on CRISPR/Cas 9 technology

A ZEP2-F, ZEP1-R technology, applied in the field of plant genetic engineering, to achieve the effect of low off-target efficiency

Inactive Publication Date: 2019-04-16
ZHEJIANG WANLI UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Editing of grape ZEP gene has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for editing grape ZEP gene fixed point based on CRISPR/Cas 9 technology
  • Method for editing grape ZEP gene fixed point based on CRISPR/Cas 9 technology
  • Method for editing grape ZEP gene fixed point based on CRISPR/Cas 9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Combined with the results of whole genome sequencing of grapes, the structural analysis of the VvZEP gene cloned from "Summer Black" grapes was carried out, and it was found that its first exon could be used as a target site. Then use the online design tool CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ) to design two sgRNAs in the first exon of the ZEP gene, namely ZEP-gRNA1 and ZEP-gRNA2, The sequence of ZEP-gRNA1 is SEQ ID NO:1: TGAAGCCACACCAGCGCCGC or TGAAGCCACACCAGCGCCGG, and the sequence of ZEP-gRNA2 is SEQ ID NO:2: TCACTGGTGACCGGATTAAT or TCACTGGTGACCGGATTGGG. Using pGTR as a template, ZEP-gRNA1 and ZEP-gRNA2 were amplified, respectively. Wherein the upstream and downstream primers of ZEP-gRNA1 are ZEP-gRNA1-F (SEQ ID NO:3) and ZEP-gRNA1-R (SEQ ID NO:4), and the upstream and downstream primers of ZEP-gRNA2 are ZEP-gRNA2-F (SEQ ID NO:4). ID NO:5) and ZEP-gRNA2-R (SEQ ID NO:6)

[0020] Amplification system: template 1ng, upstream and downstream primers 2μL each, 2×Es T...

Embodiment 2

[0025] Transfer the recombinant vector pGREBn-ZEP into Agrobacterium GV3101: Take the competent Agrobacterium stored at -80°C and warm it slightly (for example, in the palm of your hand for a while) until it partially melts, and insert it on ice when it is in a state of ice-water mixing; every 100 μL Add 0.5-1 μg of recombinant vector pGREBn-ZEP to the competent state, gently tap the bottom of the tube to mix well, and then put it on ice for 5 minutes, liquid nitrogen for 5 minutes, 37 °C metal bath for 5 minutes, and ice bath for 5 minutes; add 700 μL of LB liquid culture without antibiotics Shake culture at 28°C for 2-3 hours; centrifuge at 6000rpm for one minute to collect bacteria, take about 100 μL of supernatant and gently blow and mix the bacterial liquid, spread it on LB medium containing 50mg / L Kan, and place it upside down at 28°C Cultivate in the incubator for 48h.

[0026]Activated Agrobacterium: Pick a single colony from the plate and inoculate it in 5mL LB liquid...

Embodiment 3

[0028] Use the activated Agrobacterium to transform the cotyledon embryos of grape aseptic seedlings: under aseptic conditions, cut the cotyledon embryos of the sterile seedlings and put them in a triangular flask filled with MS culture medium (containing 50 μm / L AS) for later use. After the Agrobacterium is activated, pour out the MS culture solution in the Erlenmeyer flask, pour the activated Agrobacterium into the cotyledon embryo of the sterile seedlings, shake the bed at a constant temperature for 8 minutes, remove the bacteria solution, blot up the remaining bacteria solution on the surface, and inoculate in the co-culture Base: MS+1.0mg / L 6-BA+0.02mg / LNAA+50μm / L AS, cultured in the dark at 25°C for 3 days. Then the obtained explants were transferred to the recovery medium: MS+1.0mg / L 6-BA+0.02mg / LNAA+300mg / L penicillin, cultivated in the dark for 7 days, and then transferred to the selection medium: MS+1.0mg / L L 6-BA+0.02mg / LNAA+300mg / L penicillin+100mg / L Kan was cultur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for editing a grape ZEP gene fixed point based on a CRISPR / Cas 9 technology. According to the method, by using the CRISPR / Cas 9 technology, aiming at a grape ZEP gene, by screening and designing sgRNA, recombinant plasmid is further established, agrobacterium containing the recombinant plasmid is used for infecting grape aseptic seedling cotyledon embryos, and after screening, a mutational transgenosis grape plant is obtained. According to the method, though precise positioning, the sequence of a first exon of the grape ZEP gene is selected as a target site sequence, the sequence can be successfully identified by Cas9, the target site sequence is used as the basis for designing sgRNA, the target site sequence can be accurately knocked out, the off-target efficiency is low, the grape ZEP gene is edited through a fixed point, and the method has an important function on grape seed cultivation.

Description

technical field [0001] The invention relates to plant genetic engineering technology, in particular to a method for point-directed editing of grape ZEP gene. Background technique [0002] In recent years, CRISPR / Cas9 genome editing technology has developed rapidly and has gradually become the frontier and hotspot in the field of biological research. This technology realizes the knockout or insertion of target DNA fragments through the precise editing of genomic loci, and then changes the genetic traits, opening up new research ideas for molecular breeding. So far, molecular breeding research based on CRISPR / Cas9 technology has been carried out in rice, rapeseed, tomato and other plants, and achieved good results. Li et al. designed two sgRNAs of the MYB25 gene: GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 in the same genomic region, respectively induced two Cas9s, thereby efficiently knocking out the cotton MYB25 gene, and obtained two As a result of the deletion of the bas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/11A01H4/00A01H5/00A01H6/88
CPCA01H4/00C07K14/415C12N15/113C12N15/8213C12N2310/10C12N2310/20
Inventor吴月燕邱甜贾永红
OwnerZHEJIANG WANLI UNIV