Method for detecting nucleic acid terminal structure based on single-molecule force spectroscopy

A technology of single-molecule force spectroscopy and nucleic acid, which is applied in the field of mechanical precision measurement of biomacromolecule secondary or higher three-dimensional conformation or advanced structure, and can solve problems that have not been reported

Active Publication Date: 2019-06-07
NANKAI UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no method for probing the dynamic structure of nucleic acid ends based on single-molecule force spectroscopy has been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting nucleic acid terminal structure based on single-molecule force spectroscopy
  • Method for detecting nucleic acid terminal structure based on single-molecule force spectroscopy
  • Method for detecting nucleic acid terminal structure based on single-molecule force spectroscopy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The present invention will be described in further detail below in conjunction with specific embodiments. For the experimental methods that do not indicate specific conditions in the examples, usually follow the conventional conditions and the conditions described in the manual, or according to the conditions suggested by the manufacturer; the general equipment, materials, reagents, etc. used can be used without special instructions. Obtained commercially.

[0028] The embodiment uses click chemistry, two single-stranded DNAs to be tested, single-site modification of biotin and digoxigenin, and single-molecule magnetic tweezers to describe the present invention in detail.

[0029] Table 1 Oligonucleotide name and sequence information

[0030] Oligonucleotide name

Sequence (5′ — 3′)

Remark

Nucleic acid strand to be tested 1

TTTTATCAGATTTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGATGTAGTATGTTGAGTGT

5' azide modification

Intermediate Alkynyl M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting a nucleic acid terminal structure based on a single-molecule force spectroscopy, in particular to a single-molecule force spectroscopy method for detecting the higher structure of a free terminal of nucleic acid, and belongs to the field of mechanical precise measurement of the higher structure of biomacromolecule. The method comprises the steps of firstly through a combination reaction, anchoring a nucleic acid chain to be detected, carrying modified groups, on a DNA single-chain primer to generate a bifurcate primer; then through a polymerase chain reaction, preparing DNA carrying the nucleic acid chain to be detected, and a relieving rope DNA fragment; then through enzyme-cut and connection, generating a DNA structure substance carrying aplurality of relieving ropes having nucleic acid to be detected, and fixing the DNA structure substance between two surfaces; and finally, detecting the dynamic changes of the higher structure formedat the free terminal of the nucleic acid to be detected with the single-molecule force spectroscopy. The relieving rope DNA designed by the invention is mainly used for repeated, active, precise and real-time measurement of the higher structure at the terminal of the nucleic acid, and the application range of the single-molecule force spectroscopy is enlarged.

Description

technical field [0001] The invention relates to a method for detecting the terminal structure of nucleic acid based on single-molecule force spectroscopy, specifically a single-molecule force spectrum method for detecting the advanced structure of the free end of nucleic acid, which belongs to the mechanics of three-dimensional conformation or advanced structure of biological macromolecules. field of precision measurement. Background technique [0002] The study of high-level structure and dynamic assembly of nucleic acid free ends is an important content in the fields of RNA structure and function, chromatin damage repair pathways, and telomere biology. If the molecular dynamics of the high-order structure of nucleic acid free ends can be probed precisely, in real time, actively, and reproducibly, cellular events such as RNA processing, repair and translocation of chromatin damage, and abnormal chromosome number can be predicted to gain a deep understanding of nucleic acid-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6806G01N33/48
Inventor于仲波李宁王军力马康康梁琳
OwnerNANKAI UNIV