Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RH: delta NPT1 live attenuated vaccine for preventing toxoplasma infection and preparation method and application thereof

An attenuated live vaccine and Toxoplasma gondii technology, applied in botany equipment and methods, biochemical equipment and methods, and other methods of inserting foreign genetic materials, etc., can solve the problem of inability to achieve complete protection and unsatisfactory immune protection effect , large application limitations and other problems, to achieve good immune protection effect, reduce the number of brain cysts, and achieve the effect of great application value

Inactive Publication Date: 2019-07-12
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research and development of toxoplasmosis vaccines mainly focus on inactivated vaccines, subunit vaccines, nucleic acid vaccines, etc., but such vaccines can only provide partial immune protection for the immune body, and cannot achieve complete protection. not ideal
The attenuated vaccine has become one of the best choices for the prevention and control of toxoplasmosis because of its good immunogenicity and long immunization period. However, only one S48 toxoplasma live attenuated vaccine is allowed to be used in the prevention of abortion in goats and sheep. , the application limitations are large, so it is of great significance to accelerate the research and development of anti-toxoplasmosis attenuated vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RH: delta NPT1 live attenuated vaccine for preventing toxoplasma infection and preparation method and application thereof
  • RH: delta NPT1 live attenuated vaccine for preventing toxoplasma infection and preparation method and application thereof
  • RH: delta NPT1 live attenuated vaccine for preventing toxoplasma infection and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] In order to make the object, technical solution and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0029] 1. Construction of knockout plasmids

[0030] Design the sgRNA according to the NPT1 gene (TGME49_215490) in the TOXODB of the Toxoplasma genome website: GATGAAGGTGCAAGCTCCCG, and then use the Q5 site-directed mutagenesis kit to replace the sgRNA in pSAG1::Cas9::U6sgUPRT with NTP1 to construct the plasmid pSAG1::Cas9::U6sgNPT1 . The DHFR-resistant fragment was amplified from the plasmid pUPRT-DHFR-D by primers, and the primers used were DHFR-F: AAGCTTCGCCAGGCTGTAAA and DHFR-R: GGAATTCATCCTGCAAGTGC.

[0031] 2. Construction of Toxoplasma gondii RH:ΔNPT1 strain

[0032] Inoculate HFF cells ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a RH: deltaNPT1 live attenuated vaccine for preventing toxoplasma infection. The method comprises the steps that plasmid pSAG1::Cas9::U6sgNPT1 and DHFR resistant fragments areconstructed, a theoxoplasma gondii RH: delta NPT1 strain is constructed, and a tachyzoite suspension of toxoplasma gondii Attenuated strain RH: delta NPT1 is prepared in a cell culture medium using PBS as a solvent. The method establishes an immunization dosage form of the live attenuated vaccine, and proves the immunization procedure and dosage thereof. The animal experiment shows that the live attenuated vaccine prepared by the method has a strong immunoprotective effect on acute toxoplasma gondii infection or chronic toxoplasma gondii infection, can be applied to the immune protection of the acute toxoplasma infection or the chronic toxoplasma infection, and has a great application value in the prevention and control of toxoplasma gondii.

Description

technical field [0001] The invention belongs to the technical field of toxoplasma gondii live attenuated vaccine, in particular to a RH:ΔNPT1 live attenuated vaccine for preventing toxoplasma gondii infection and its preparation method and application. Background technique [0002] Toxoplasma gondii (Toxoplasma gondii) is an obligate intracellular parasitic opportunistic pathogenic protozoa, which can infect almost all warm-blooded animals including humans, and is widely distributed in the world. Toxoplasma parasitizes exclusively in nucleated cells, and its intermediate host is common and non-specific. Its infection can cause serious encephalopathy, eye disease, miscarriage, stillbirth, etc., which seriously endanger human health and cause huge economic losses to animal husbandry. . Toxoplasma gondii has two forms of tachyzoites and bradyzoites in the intermediate host. The existing drug treatment only works on the tachyzoite stage of the parasite, and has little effect on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/002A61P33/02C12N15/90C12N15/79C12N15/30
CPCA61K39/002A61K2039/522A61P33/02C07K14/45C12N15/79C12N15/902C12N2810/10
Inventor 王金磊杨文彬侯俊玲梁勤立陈凯周东辉朱兴全
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com