Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for targeted knockout of chicken irf7 gene and its application in vaccine preparation

A gene and gene knockout technology, applied in the field of genetic engineering, can solve problems such as low knockout efficiency, and achieve high efficiency and speed.

Active Publication Date: 2021-06-18
SHANGHAI JIAOTONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] CRISPR / Cas9 has been used for gene knockout in various model animals, however, the application of this technology in avian gene knockout is still seldom, and the existing applications in poultry have reported low knockout efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for targeted knockout of chicken irf7 gene and its application in vaccine preparation
  • Method for targeted knockout of chicken irf7 gene and its application in vaccine preparation
  • Method for targeted knockout of chicken irf7 gene and its application in vaccine preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1, the method of using CRISPR / Cas9 technology to knock out the IRF7 gene of DF-1 cells

[0062] 1. Design of gRNA targeting chicken IRF7

[0063] Search the gene sequence of chicken IRF7 through GeneBank, and its sequence is shown in SEQ ID NO.1.

[0064] Exons of this gene were used as target design regions. Schematic diagram of the gRNA sequence designed for the chicken IRF7 gene based on CRISPR / Cas9 figure 1 As shown, the designed gRNA sequence is:

[0065] IRF7-gRNA1:AAGGCCAGCGGCAGGTACGAGGG SEQ ID NO.2;

[0066] IRF7-gRNA2: AAGGGATGCGGAAGATACGGCGG SEQ ID NO.3.

[0067] 2. Construction of CRISPR / Cas9 targeting vector

[0068] According to the gRNA1 and gRNA2 sequences designed in 1, respectively design and synthesize two pairs of reverse complementary oligonucleotides, the synthesized two pairs of oligonucleotide sequences are:

[0069] 1) 5'AAGGCCAGCGGCAGGTACGAGGG 3' SEQ ID NO.4;

[0070] 3'TTCCGGTCGCCGTCCATGCTCCC 5' SEQ ID NO.5;

[0071] 2) 5'AAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for targeted knockout of chicken IRF7 gene and its application in vaccine preparation; based on CRISPR / Cas9, gRNA target sequence for chicken IRF7 gene is designed and connected to VK001‑02 plasmid to obtain chicken IRF7 gene Targeting vectors; targeting vectors were transfected into chicken fibroblasts using liposomes. After the successfully transfected cells were screened by puromycin, the chicken fibroblasts knocked out of the chIRF7 gene were screened by the limiting ratio dilution method. The knockout cell line was verified by TCID50 to show that it can increase the virus titer. This method is suitable for the research on the role and function of the important transcription factor IRF7 in the interferon expression pathway mediated by chicken innate immune pattern recognition receptors. At the same time, the knockout cell line constructed by the invention can down-regulate the expression level of interferon beta mediated by many innate immune pathways, which is beneficial to virus reproduction and can be used for virus amplification in vaccine preparation.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for targeted knockout of chicken IRF7 gene using CRISPR / Cas9 technology and its application in vaccine preparation. Background technique [0002] CRISPR / Cas9 is an innate immune system widely found in bacteria and archaea. The basic structure of the system includes tracrRNA sequence region, cas gene sequence region and CRISPR sequence region. When the phage invades the host for the first time, the protein complex encoded by the cas gene lock cleaves the terminal spacer sequence on the phage DNA, and then integrates the cleaved fragment into the CRISPR 5' end of its own DNA. When the phage invades the host again, the CRISPR sequence region transcribes pre-crRNA, which matures into crRNA under the joint action of RNase III, cas9 and tracrRNA. The crRNA and tracrRNA form a complex, which is complementary to the specific site of the phage DNA and bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/90C12N5/10C12Q1/686
CPCC07K14/4702C12N15/113C12N15/85C12N15/907C12N2310/10C12Q1/686C12N2310/20C12Q2531/113
Inventor 孙建和程玉强伦敏翔严亚贤
Owner SHANGHAI JIAOTONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More