S-adenosylmethionine synthetase mutant and preparation method thereof

A technology of adenosylmethionine and synthase, which is applied in the field of S-adenosylmethionine synthase mutant and its preparation, and can solve the problems of low enzyme catalysis efficiency, ineffective accumulation, low bioavailability and the like

Active Publication Date: 2019-08-20
ZHEJIANG UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enzyme also has serious product inhibition, resulting in low catalytic efficiency and SAM cannot be effectively accumulated.
Although adding high-concentration sodium p-toluenesulfonate can overcome product inhibition, there is a problem of low bioavailability when the finished product of SAM sodium p-toluenesulfonate is used as a drug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • S-adenosylmethionine synthetase mutant and preparation method thereof
  • S-adenosylmethionine synthetase mutant and preparation method thereof
  • S-adenosylmethionine synthetase mutant and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Construction of S-adenosylmethionine synthetase recombinant bacteria

[0025] Select the S-adenosylmethionine synthetase derived from Escherichia coli K12, use PCR technology, use the E.coli K12 genome as a template, and use metK-F:5'-GATCC GAATTC ATGGCAAAACACCTTTTTACG-3' (SEQ ID NO.5) and metK-R:5'-GTG CTCGAG TTACTTCAGACCGGCAGCAT (SEQ ID NO.6) was used as a primer to amplify the metK gene, and EcoR I and Xho I restriction endonuclease sites (underlined) were introduced at its 5' end and 3' end respectively. The PCR reaction system (50 μL) was: 25 μL of 2×PrimeSTAR Max Premix, 1 μL of template DNA, 1 μL of upstream and downstream primers, and 22 μL of sterile water. The PCR reaction conditions were: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 10 s, and 30 cycles; extension at 72°C for 5 min. Verify the PCR amplification product with 1% agarose gel electrophoresis, when the target band...

Embodiment 2

[0026] Example 2: Single point mutation of S-adenosylmethionine synthetase gene

[0027] After culturing the recombinant strain E.coli BL21(DE3) / pET-28a(+)-metK in Example 1 overnight, extract the recombinant plasmid pET-28a(+)-metK, and use it as a template to fix the site at position 303 mutation. The FastMutagenesis system kit was used for site-directed mutagenesis, and I303V-F: 5'-TCAGGTTTCCTACGCAGTCGGCGTGGC-3' (SEQ ID NO.7) and I303V-R: 5'-CCAGAAGGCACTTTCTCAGTACCGAAAG-3' (SEQ ID NO.8) were used as primers to carry out the whole Plasmid PCR amplification (94°C 5min; 94°C 20s, 60°C 20s, 72°C 60s, 30 cycles; 72°C 10min). After the PCR product was verified by agarose gel electrophoresis, the template was digested with the restriction enzyme DpnI, and then the digested product was transferred into E.coli BL21(DE3) competent cells by heat shock method to obtain a single point mutation recombinant bacterium . The amino acid sequence of the single point mutation is SEQ ID NO.1...

Embodiment 3

[0028] Example 3: Construction of two point mutations in S-adenosylmethionine synthetase

[0029] The amino acid sequences of eMAT, SAM2 and sMAT were homologously compared, and the corresponding mutation sites in eMAT and pDS16 and pDS56 were found, and the points that could be mutated were: K18R, L31P, I65V, E324G, L329V( figure 2, marked with a triangle). Using the mutant I303V coding gene as a template, K18R-F:5'-TCTGAAGGGCATCCTGACAGAATTGCTGAC-3'(SEQ ID NO.9) and K18R-R:5'-CTGTCAGGATGCCCTTCAGAGACGGAC-3'(SEQ ID NO.10); I31P-F :5'-TGATGCCGTTTTAGACGCGCCCCTCGAACAG-3'(SEQ ID NO.11) and I31P-R:5'-GGCGCGTCTAAAACGGCATCAGAAATTTGG-3'(SEQ ID NO.12); I65V-F:5'-ACCAGCGCCTGGGTAGACGTCGAAGAGATC-3'(SEQ ID NO. .13) and I65V-R: 5'-CGTCTACCCAGGCGCTGGTGGTGATTTCG-3' (SEQ ID NO. 14); E324G-F: 5'-TACTGAGAAAGTGCCTTCTGGACAACTGACC-3' (SEQ ID NO. 15) and E324G-R: 5'-CCAGAAGGCACTTTTCAGTACCGAAAG -3' (SEQ ID NO.16); L329V-F:5'-TTCTGAACAACTGACCCTG GTG GTACGTGAG-3' (SEQ ID NO.17) and L329V-R:5'-CCAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an S-adenosylmethionine synthetase mutant and a preparation method of the mutant. The mutant is prepared by single-point, double-point or three-point mutation of a site 65, a site 104 and a site 186 in an amino acid sequence shown as SEQ ID NO. (sequence identifier number) 1. Compared with wild S-adenosylmethionine synthetase, the mutant increases an accumulation amount ofSAM (S-adenosylmethionine) to be increased by 1.06mM in a 10mM substrate reaction system. At the same time, enzyme activity of the mutant is 3.3 times that of wild eMAT (escherichia coli S-adenosylmethionine synthetase), and is 6.02+ / -0.22U / mg. The possibility is further provided for enzyme method preparation of SAM, and a clue is provided for improving a product inhibition phenomenon of an enzymeby molecular modification.

Description

technical field [0001] The invention relates to an S-adenosylmethionine synthetase mutant with improved catalytic activity and reduced product inhibition and a preparation method thereof, belonging to the field of genetic engineering. Background technique [0002] S-adenosylmethionine (SAM) is an important physiologically active substance that participates in various biochemical reactions such as transmethylation, transthiolation, and transaminopropylation in organisms. Clinically, SAM has a significant therapeutic effect on the treatment of hepatitis, depression, arthritis, etc., so the market demand is huge. [0003] At present, SAM is mainly produced by microbial fermentation, but this method has problems such as long production cycle, low conversion rate of substrate, complicated extraction process, and easy auto-racemization of the product. In comparison, the enzyme-catalyzed method has the characteristics of short reaction time, high stereoselectivity, and simple puri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/70C12N1/21C12R1/19
CPCC12N9/1085C12N15/70
Inventor林建平王秀朱力蒋亦琪孙志娇吴绵斌杨立荣
OwnerZHEJIANG UNIV