Transgenic soybean indicating auxin concentrations
A technology of transgenic soybean and auxin, applied in the field of molecular genetics, can solve problems such as affecting the nutrient distribution of leaves and fruits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] This embodiment provides a method for obtaining the transgenic soybean indicating the auxin concentration, comprising the following steps:
[0018] (1) The auxin key gene promoter was obtained by PCR amplification technology.
[0019] Using Takara PrimeSTAR GXL high-fidelity enzyme, using the synthesized DR5V2 fragment as a template for PCR amplification, the forward and reverse primers are:
[0020] AttB-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGATCCAAGCTTCCGACAC
[0021] AttB-R: GGGGACCACTTTGTACAAGAAAGCTGGGTTCTGCAGTGTAATTGTAACTGTAAATAGTAATTGT
[0022] (2) Using Gateway's molecular cloning method to construct the product obtained by S1 on the pGWB633 vector
[0023] After recovering the PCR product obtained from S1, first use the Gateway BP reaction to construct the obtained DR5V2 promoter onto the pDONR221 vector. The reaction system is: 2 μL PCR recovery product, 2 μL pDONR221, 5 μL ddH 2 O, 1 μL BPase. After reacting at 25°C for 4 hours, take out the competent DH5a fr...
Embodiment 2
[0038] This embodiment provides a kind of application of transgenic soybean in indicating auxin concentration, comprising the following steps:
[0039] (1) The cultivation of transgenic soybean described in embodiment 1
[0040] DR5V2 transgenic soybean seeds were sown in vermiculite, and then placed in a soybean growth room (25°C, light duration 14 hours) for germination and growth. On the 10th day after the seeds were sown, the seedlings were taken out from the vermiculite and the vermiculite was washed, and then hormone treatment and nodulation treatment were performed respectively. Root hormone treatment process: Divide the seedlings into four groups, with 3 plants in each group; then culture them with total nitrogen nutrient solution containing DMSO, IAA, NAA, and IAA-asp, the hormone concentration is 0.1 μM, and the culture time is 24 hours. Nodulation treatment process: soak the seedlings in the resuspension solution containing rhizobia BXYD3 for 2 hours, then culture ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



