Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenic soybean indicating auxin concentrations

A technology of transgenic soybean and auxin, applied in the field of molecular genetics, can solve problems such as affecting the nutrient distribution of leaves and fruits

Inactive Publication Date: 2019-08-23
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Excessive accumulation of auxin causes unlimited growth of root nodules, which affects the nutrient distribution of the aboveground leaves and fruits of legume crops; and too low auxin concentration also inhibits the initiation of root nodules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic soybean indicating auxin concentrations
  • Transgenic soybean indicating auxin concentrations
  • Transgenic soybean indicating auxin concentrations

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] This embodiment provides a method for obtaining the transgenic soybean indicating the auxin concentration, comprising the following steps:

[0018] (1) The auxin key gene promoter was obtained by PCR amplification technology.

[0019] Using Takara PrimeSTAR GXL high-fidelity enzyme, using the synthesized DR5V2 fragment as a template for PCR amplification, the forward and reverse primers are:

[0020] AttB-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGATCCAAGCTTCCGACAC

[0021] AttB-R: GGGGACCACTTTGTACAAGAAAGCTGGGTTCTGCAGTGTAATTGTAACTGTAAATAGTAATTGT

[0022] (2) Using Gateway's molecular cloning method to construct the product obtained by S1 on the pGWB633 vector

[0023] After recovering the PCR product obtained from S1, first use the Gateway BP reaction to construct the obtained DR5V2 promoter onto the pDONR221 vector. The reaction system is: 2 μL PCR recovery product, 2 μL pDONR221, 5 μL ddH 2 O, 1 μL BPase. After reacting at 25°C for 4 hours, take out the competent DH5a fr...

Embodiment 2

[0038] This embodiment provides a kind of application of transgenic soybean in indicating auxin concentration, comprising the following steps:

[0039] (1) The cultivation of transgenic soybean described in embodiment 1

[0040] DR5V2 transgenic soybean seeds were sown in vermiculite, and then placed in a soybean growth room (25°C, light duration 14 hours) for germination and growth. On the 10th day after the seeds were sown, the seedlings were taken out from the vermiculite and the vermiculite was washed, and then hormone treatment and nodulation treatment were performed respectively. Root hormone treatment process: Divide the seedlings into four groups, with 3 plants in each group; then culture them with total nitrogen nutrient solution containing DMSO, IAA, NAA, and IAA-asp, the hormone concentration is 0.1 μM, and the culture time is 24 hours. Nodulation treatment process: soak the seedlings in the resuspension solution containing rhizobia BXYD3 for 2 hours, then culture ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a transgenic soybean indicating auxin concentrations. The soybean repeats construction of DR5V2 promoters many times by using short promoter regions of auxin responding key genes, and beta-glucosidase (GUS) reporter genes are connected. The transgenic soybean can respond to the change of the auxin concentrations. After a GUS substrate, namely, 5-bromine-4-chlorine-3-indole-beta-gluconate(X-gluc), is stained, the distribution areas and concentration change of the auxin can be observed by a microscopy. Compared with a previously published soybean-auxin indicator plant pGH3-GUS, the provided DR5-V2-GUS transgenic soybean is more accurate in auxin indicating.

Description

technical field [0001] The invention belongs to the field of molecular genetics, and provides a kind of transgenic soybean indicating auxin concentration and application thereof. Background technique [0002] Auxin is an important plant hormone. It participates in various processes of plant growth and development, such as the development of plant embryo cells, the development of vascular bundles, the formation of lateral roots, the growth of stems and lateral branches, the development of floral organs, etc., covering almost all the processes of plant growth. Among them, the gradient distribution of auxin concentration is closely related to the establishment of plant morphology, and a reasonable gradient distribution of auxin is conducive to the establishment and formation of plant organ primordia. In-depth research on the distribution and dynamic changes of auxin in various organs of plants is not only conducive to our in-depth understanding of plant growth and development ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H6/54
CPCC12N15/8212C12N15/8238
Inventor 陈栩陈志威高震董衍坤陈娇梅
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products