Anoplophora glabripennis odorant binding protein OBP45, OBP46 and application in screening attractants thereof

An odor-binding protein and A. chinensis technology, which can be applied in applications, proteomics, animal/human peptides, etc., can solve problems such as unsatisfactory attracting effect, and achieve the effect of improving screening efficiency.

Inactive Publication Date: 2019-09-24
BEIJING FORESTRY UNIVERSITY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some attractants have also been tested for monitoring effect, but the attracting effect is not ideal (the number of traps in multiple years and multiple traps does not exceed 100, or the average trapping amount per trap per week is less than 5, while other closely related genera For example, the number of attractants of the genus Mocha can trap more than 2000) (Nehme et al., 2010; Nehme et al., 2014)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anoplophora glabripennis odorant binding protein OBP45, OBP46 and application in screening attractants thereof
  • Anoplophora glabripennis odorant binding protein OBP45, OBP46 and application in screening attractants thereof
  • Anoplophora glabripennis odorant binding protein OBP45, OBP46 and application in screening attractants thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Extraction and reverse transcription of total RNA from the antennae of Beetle glabrata

[0035] 1.1 Extraction of total RNA from antennae of Beetle glabrata

[0036] Collect the antennae of the newly emerged male and female Beetles glabrata, and extract the total RNA of the antennae, using TRIzol reagent (Ambion) and RNeasy Plus Mini kit (No.74134; Qiagen, Hilden, Germany) according to the instructions, and the specific steps are as follows:

[0037] (1) Take 50-100 mg of antennae of male and female adults of Beetleus glabrata and Beetleus glabrata respectively, put them in a 2ml centrifuge tube with grinding beads, add 1ml of Trizol reagent, shake and grind the cells;

[0038] (2) Place at room temperature for 30 minutes to reduce DNA contamination;

[0039] (3) 4°C, 12000g, 10min centrifugation;

[0040](4) Take about 800 μl of the supernatant into a clean 1.5ml centrifuge tube;

[0041] (5) Draw 3-5 times with a sterile syringe, cut genomic DNA and lyse ...

Embodiment 2

[0061] Cloning of Example 2 Odor Binding Protein OBP45 and OBP46 Genes of Beetle glabrata

[0062] 2.1 Primer design and PCR reaction

[0063] According to the sequences of AglaOBP45 and AglaOBP46 obtained from the transcriptome sequencing of the antennae of Beetle glabrata, the online software Primer3( http: / / bioinfo.ut.ee / primer3-0.4.0 / ) respectively designed the following primers to clone the entire ORF regions of AglaOBP45 and AglaOBP46.

[0064] AglaOBP45F: GGACAACTGCAACTCTTTGTCG

[0065] AglaOBP45R: GAGACCACAGATGGTGATGAGC

[0066] AglaOBP46F: GGTTCTGGTGATTGTGTATTTGG

[0067] AglaOBP46R: TACTCGCCGGTCCGTAAGATAG

[0068] Use TAKARA’s high-fidelity enzymes for PCR amplification of the target gene, configure the system on ice, SYBR PremixEx Taq II 12.5 μL, forward primer 0.75 μL, reverse primer 0.75 μL, template cDNA 1 μL, ddH 2 O 0.75 μL, total volume 25 μL. The PCR reaction conditions were: 98°C, 10s pre-denaturation; 55°C, 5s; 72°C, 5s, 34 cycles. The product was ...

Embodiment 3

[0080] The construction of embodiment 3 prokaryotic expression vector

[0081] 3.1 Amplification of target fragments and extraction of recombinant plasmids

[0082] Based on the cloned full-length gene sequences of AglaOBP45 and AglaOBP46, the signal peptide sequence was removed, and primers with enzyme cleavage sites (NdeI: CATATG, XhoI: CTCGAG) were designed to amplify the target fragment. The primer sequences are as follows:

[0083] AglaOBP45F:ACTTACATATGCTGATAAGATTAGGTGCCGCGTGC

[0084] AglaOBP45R: ACTACTCGAGTTATACTAAGAAGTAAGCATCTGGA

[0085] AglaOBP46F: ACTTACATATGCTGATAAGATTAGGTGCCGCGTGC

[0086] AglaOBP46R: ACTACTCGAGTTACGGATGGGGCAACTTGGGAA

[0087] After the cloned strains were sequenced and verified to be correct, they were expanded and cultivated. Then use the AxyPrep Plasmid DNA Mini Kit to extract the plasmid to obtain the plasmid with the target fragment.

[0088] 3.2 Double digestion of cloning plasmid and expression vector and connection of restriction pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses anoplophora glabripennis odorant binding protein OBP45, OBP46 and genes thereof. The invention further discloses an attractant screening method based on the anoplophora glabripennis odorant binding protein OBP45, OBP46. The anoplophora glabripennis odorant binding protein OBPs homology modeling, computer virtual screening and a fluorescence competition experiment are combined, the screening efficiency of odor molecules is greatly improved, and a new strategy is provided for the screening and design of a formula of an anoplophora glabripennis olfactory attractant. According to a fluorescence competitive combination method, the combining capacity of 34 anoplophora glabripennis host main volatiles and 7 pheromone molecules is determined, a fluorescence competitive compound with an IC50 value (20 [mu] mol / L, or the dissociation constant KD is (20 [mu] mol / L) is determined as the olfactory attractant suitable for anoplophora glabripennis.

Description

technical field [0001] The invention belongs to the technical field of insect attractants, and in particular relates to odor-binding proteins OBP45 and OBP46 of Beta glabrata and their application in screening attractants. Background technique [0002] Anoplophora glabripennis (Motschulsky) belongs to the Coleoptera order Coleoptera, Cerambycidae family Cerambycidae, Lamiinae subfamily Lamiinae, Anoplophora genus Anoplophora, is an important tree borer pest. The insect is widely distributed in my country and is seriously harmful. In the past 20 years, Beetle glabrata has rapidly spread to the deep regions of Northwest and Northeast my country, colonized and caused serious harm (Liu Zhaoyang, 2016). With the increasing frequency of international trade, it has become an important international pest, and it has been colonized and seriously endangered in many regions of North America; in Europe, the insect has also been successfully colonized in some countries (EPPO reports over...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12G16B5/00G16B20/00G16B30/10G16B50/00
CPCC07K14/43563G16B5/00G16B20/00G16B30/10G16B50/00
Inventor陶静王菁桢骆有庆宗世祥
OwnerBEIJING FORESTRY UNIVERSITY