A protease-producing polylactic acid-degrading bacterium and its application

A technology for producing protease and polylactic acid, which is applied in the direction of bacteria, hydrolase, and microorganism-based methods, can solve the problems of difficult degradation, limited types and quantities of microorganisms, and few PLA-degrading bacteria, so as to make up for the limited range of pH tolerance , good degradation effect, and strong adaptability

Active Publication Date: 2020-12-25
内蒙古颐祥杰成科技有限责任公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, current studies have found that the degradation of PLA is mainly closely related to the physical and chemical properties of the environment, such as pH, temperature, and humidity. It is reflected that the degradation rate of PLA in the northwest region is much lower than that in the southwest region. In addition, the types and quantities of microorganisms in the environment in the northwest region are limited. This has severely limited the application of PLA. Furthermore, although PLA is an aliphatic polyester, it is difficult to be degraded by microbial lipase and can only be degraded by protease secreted by microorganisms.
Therefore, there is an urgent need for an environment-tolerant PLA high-efficiency degrading bacteria to solve the problem of low degradation rate of PLA in different regions.
[0003] At present, there are very few studies on PLA degrading bacteria. The PLA degrading bacteria reported at home and abroad mainly include Lentzea waywayandensis, Bacillus, Laceyella sacchar, oligotroph Stenotrophomonas and Actinomycetes (Actinodura), but generally have the problem of low degradation rate, and the strains have limited tolerance to pH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A protease-producing polylactic acid-degrading bacterium and its application
  • A protease-producing polylactic acid-degrading bacterium and its application
  • A protease-producing polylactic acid-degrading bacterium and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The isolation of embodiment 1 bacterial strain

[0036] Collect the soil of a farmland with PLA / PBAT in Weifang, Shandong, weigh 10g of soil in a 150mL triangular flask of 90mL sterile water, and configure 10 -1 to 10 -6 The soil bacteria suspension with a series of concentration gradients was inoculated in the inorganic salt medium with PLA as the only carbon source. After culturing in a constant temperature incubator at 37°C for 3 days, the growth of microorganisms on the medium was observed, and a single colony was picked. Continuously inoculated several times in the inorganic salt medium with PLA as the only carbon source for isolation and purification until a strain of bacteria was isolated, and then observed its colony morphology, as shown in figure 1 As shown, the colony is milky white and round, with smooth and moist surface, flat edges and opaque.

Embodiment 2

[0037] The identification of embodiment 2 bacterial strains

[0038] 1. Physiological and biochemical experiments of strains

[0039] Pick a single colony of this strain on the inorganic salt medium with PLA as the only carbon source, and test the main physiological and biochemical experiments of this strain according to the "Common Bacterial System Identification Manual". The results are shown in Table 1 below. The characteristics are: V-P test and contact enzyme are positive; Gram staining test, M.R test, starch hydrolysis test and oil hydrolysis test are negative.

[0040] Table 1 Physiological and biochemical experiment results

[0041]

[0042] 2. Identification of the 16S rRNA gene sequence of the strain

[0043]The strain was cultured on LB medium for 3 days at 37°C on a shaker with a rotation speed of 130r / min, the DNA of the strain was extracted by boiling water, and the bacterial general primer 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (AAGGAGGTGATCCAAGCC) were used ...

Embodiment 3

[0045] Embodiment 3 bacterial strain produces protease ability identification

[0046] Inoculate this bacterium on skimmed milk powder culture medium, culture at 37°C for 3 days, observe the obvious transparent hydrolysis circle under the colony, it can be seen that this bacterium can produce protease.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a protease-producing polylactic acid (PLA) degrading bacterium. The present invention isolates and screens a protease-producing polylactic acid-degrading bacterium Pseudomonas from a soil where polylactic acid / polybutylene terephthalate adipate (PLA / PBAT) mulch film is laid in Weifang, Shandong, and It is named Pseudomonas sp.strain LXM88, and is preserved in China General Microorganism Culture Collection and Management Center with the preservation number (CGMCC 18058). The advantage of the invention is that the bacterium produces protease for degrading PLA, and the bacterium has good pH tolerance and good ability to degrade PLA. The pseudomonas and its protease can be used as enzyme preparations, biological bacteria agents and biological enhancers for environmental restoration of PLA and PLA-based biodegradable materials in the environment, and have good application value.

Description

technical field [0001] The invention relates to polylactic acid degradation technology, in particular to a protease-producing PLA-degrading bacterium (Pseudomonassp.strain LXM88) and its application. Background technique [0002] Polylactic acid (PLA) is an aliphatic biodegradable material. Because it has good thermoplasticity, biocompatibility and performance of traditional plastics, and PLA can be degraded by microorganisms and their enzymes in the environment, it has good The biodegradability of PLA makes it widely used in agriculture, food, packaging and medical industries. However, current studies have found that the degradation of PLA is mainly closely related to the physical and chemical properties of the environment, such as pH, temperature, and humidity. It is reflected that the degradation rate of PLA in the northwest region is much lower than that in the southwest region. In addition, the types and quantities of microorganisms in the environment in the northwest r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20C12N9/50A62D3/02A62D101/28C12R1/38
CPCA62D3/02A62D2101/28C12N9/50C12N1/205C12R2001/38
Inventor张敏贾昊李成涛
Owner内蒙古颐祥杰成科技有限责任公司