Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

EGFR/L858R mutation hypersensitivity detection kit

A technology of L858R and detection kit, applied in the biological field, can solve the problems such as the sensitivity to be improved, and achieve the effects of cheap detection, improved efficiency and simple operation

Pending Publication Date: 2019-10-18
陈超
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In clinical application, lung cancer patients with resected primary tumors are more likely to have no molecular detection of L858R mutation due to inability to obtain tumor tissue
Some prospective studies have shown that compared with tumor tissue, the detection of EGFR mutations in blood circulating tumor DNA (ctDNA) also has higher specificity, but the sensitivity needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EGFR/L858R mutation hypersensitivity detection kit
  • EGFR/L858R mutation hypersensitivity detection kit
  • EGFR/L858R mutation hypersensitivity detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Design of foaming enrichment primers for detection of EGFR gene L858R mutation and verification of its specificity and sensitivity.

[0023] Primer design: The mutation point of EGFR is rs121434568 (NCBI SNP database), and the sequence on both sides is: CATGTCAAGATCACCAGATTTTGGGC[G / T]GGCCAAACTGCTGGGTGCGGAAGAG, where the wild type is T, the mutant type is G, and the amino acid L [Leu] after mutation changes to R [ Arg], forming a missense mutation. Using the 250 bp before and after the mutation position as the template sequence, design the upstream foaming enrichment primer of the L858R mutation, and the downstream primer of the EGFR gene ( figure 1 ).

[0024] Blood DNA extraction: take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, add 50 μl of mesoporous nanomagnetic beads; Adjust the Na+ concentration to 0.4 mol...

Embodiment 2

[0027] Example 2 is used for the detection of clinical samples by the EGFR / L858R mutation hypersensitive detection kit.

[0028] 1. Clinical sample preparation, 20 cases of lung cancer L858R mutation samples confirmed by molecular detection of tissue slices, 1ml of whole blood was taken for backup, and another whole blood sample of normal people was taken as a control.

[0029] 2. For blood DNA extraction, take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, and add 50 μl of mesoporous nano-magnetic beads ;Use NaCl to adjust the Na+ concentration to 0.4 mol / L, vortex for 1 min; absorb at room temperature for 10 min; vortex the centrifuge tube for 5 sec, immediately place it on a magnetic adsorption rack, let it stand for 5 sec, and discard the liquid; Repeat the above steps twice with 300 μl of washing solution (0.4 mol / L NaCl); open ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an EGFR / L858R mutation hypersensitivity detection kit and application thereof. The EGFR / L858R mutation hypersensitivity detection kit is characterized by comprising an L858R mutation upstream foaming enrichment primer, an EGFR gene downstream primer, a qPCR reaction system reagent and positive plasmids of mutant and wild type EGFR genes. The kit can be used for qualitative detection of lung cancer EGFR / L858R mutant serum free DNA, and has a lower limit of experimental detection of 0.1%. A detection method using the kit only relates to dye method qPCR, does not relate tosynthesis and modification of probes, is low in detection cost, and is beneficial to saving gene detection cost of vast patients.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an EGFR / L858R mutation hypersensitive detection kit. Background technique [0002] The L858R mutation results in the substitution of arginine (R) for leucine (L) at position 858 in EGFR, which occurs in exon 21 containing the kinase domain. The L858R mutation occurs at a frequency of about 43% in lung tumors, and is highly correlated with the efficacy of various EGFR tyrosine kinase inhibitors (tyrosine kinase inhibitors, TKIs). In the process of lung cancer metastasis, EGFR mutation can be used to predict the sensitivity of patients to TKIs drugs, including the first-generation drugs Gefitinib (Iressa) and erlotinib (Tarceva) and the second-generation drug Afatinib (Gilotrif). Patients with EGFR-mutated tumors have a better prognosis compared with EGFR-wild-type tumors. TKI-treated patients with EGFR-mutant tumors had a longer progression-free survival than those who received chem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2531/113C12Q2563/107C12Q2545/113
Inventor 张嘉禧谢少洵陈嘉怡张逸任郭子君陈超
Owner 陈超
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com