EGFR/L858R mutation hypersensitivity detection kit
A technology of L858R and detection kit, applied in the biological field, can solve the problems such as the sensitivity to be improved, and achieve the effects of cheap detection, improved efficiency and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Design of foaming enrichment primers for detection of EGFR gene L858R mutation and verification of its specificity and sensitivity.
[0023] Primer design: The mutation point of EGFR is rs121434568 (NCBI SNP database), and the sequence on both sides is: CATGTCAAGATCACCAGATTTTGGGC[G / T]GGCCAAACTGCTGGGTGCGGAAGAG, where the wild type is T, the mutant type is G, and the amino acid L [Leu] after mutation changes to R [ Arg], forming a missense mutation. Using the 250 bp before and after the mutation position as the template sequence, design the upstream foaming enrichment primer of the L858R mutation, and the downstream primer of the EGFR gene ( figure 1 ).
[0024] Blood DNA extraction: take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, add 50 μl of mesoporous nanomagnetic beads; Adjust the Na+ concentration to 0.4 mol...
Embodiment 2
[0027] Example 2 is used for the detection of clinical samples by the EGFR / L858R mutation hypersensitive detection kit.
[0028] 1. Clinical sample preparation, 20 cases of lung cancer L858R mutation samples confirmed by molecular detection of tissue slices, 1ml of whole blood was taken for backup, and another whole blood sample of normal people was taken as a control.
[0029] 2. For blood DNA extraction, take 1 ml of whole blood, centrifuge at 2000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; repeat the centrifugation, transfer the remaining supernatant to the centrifuge tube, and add 50 μl of mesoporous nano-magnetic beads ;Use NaCl to adjust the Na+ concentration to 0.4 mol / L, vortex for 1 min; absorb at room temperature for 10 min; vortex the centrifuge tube for 5 sec, immediately place it on a magnetic adsorption rack, let it stand for 5 sec, and discard the liquid; Repeat the above steps twice with 300 μl of washing solution (0.4 mol / L NaCl); open ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



