A kind of lactic acid bacteria composition and application thereof
A composition and technology of lactic acid bacteria, applied in the direction of application, lactobacillus, streptococcus/lactococcus, etc., can solve the problems of low folic acid production, poor water retention capacity, low viscosity, etc., and achieve strong folic acid metabolism, excellent production performance, and folic acid The effect of content increase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 A lactic acid bacteria composition, consisting of Streptococcus thermophilus inm25-ST, Lactobacillus delbrueckii subsp. bulgaricus inm25-LB and promoting factors, the composition is used to improve the folic acid metabolism capacity of Lactobacillus sake LZ217 during fermentation .
[0022] A lactic acid bacteria composition, Lactobacillus delbrueckii subspecies bulgaricus, the strain name is inm25-LB, the preservation number of the strain is CGMCC No.15445, the preservation date is: March 12, 2018, and the preservation unit is: China Microbial Strains General Microbiology Center of the Preservation Management Committee, the preservation address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.
[0023] The sequence of Lactobacillus delbrueckii subsp. bulgaricus inm25-LB provided by the present invention is shown.
[0024] gagtttgatc ctggctcatg acgatcgctg gcggcgtgcc taatacatgc aagtcgagcgagctgaattc aaagattcct tcggggtgat ttgttggatg ctagcggcg...
Embodiment 2
[0036] The bacterial strain screening method of embodiment 2 Streptococcus thermophilus and Lactobacillus delbrueckii subspecies
[0037] Screening of Excellent Streptococcus Thermophilus and Aroma-producing Streptococcus
[0038] Using the single-strain fermented milk texture, viscosity, whey precipitation after simulated transportation, and flavor production as indicators, 4 strains were selected from more than 200 strains of Streptococcus thermophilus as candidate Streptococcus thermophilus strains.
[0039] Screening of Lactobacillus delbrueckii subsp. bulgaricus with excellent post-acidification performance
[0040] Taking the low-temperature (4°C 7d) acidity change and fermentation end point (80oT) time of single-strain fermented milk as indicators, 4 strains were selected from more than 100 strains of Lactobacillus delbrueckii subsp. subspecies strain.
[0041] Screening of compositions that promote the growth of Lactobacillus sake lz217 and the metabolism of folic ac...
Embodiment 3
[0043] The preparation of embodiment 3 lactic acid bacteria composition
[0044] 1. Cultivation and counting of fermenting lactic acid bacteria strains
[0045] Streptococcus thermophilus inm25-ST and Lactobacillus delbrueckii subsp. bulgaricus inm25-LB preserved in glycerol tubes were respectively activated for 2 to 3 times, and the Streptococcus thermophilus strain inm25-ST was inserted into M17 liquid medium at 42°C After culturing for 16 hours, Lactobacillus delbrueckii subsp. bulgaricus inm25-LB was inserted into MRS liquid medium, and cultured at 42°C for 20 hours. Under sterile conditions, the cells were centrifuged at 3000 rpm for 6 minutes, the supernatant was removed, and the cells were collected. Calculate the bacterial count separately.
[0046] 2. Preparation of strain composition
[0047] According to the bacterial count, Streptococcus thermophilus inm25-ST and Lactobacillus delbrueckii subsp. bulgaricus inm25-LB were mixed according to the bacterial count of 1...
PUM
Property | Measurement | Unit |
---|---|---|
viscosity | aaaaa | aaaaa |
viscosity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com