Detection method for mitochondrial copy number and sequence variation
A mitochondrial and copy number technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as large differences between batches, unsuitable for large-scale detection, and low throughput
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1. Detection method of mitochondrial copy number and sequence variation
[0087] The flow process of the method for building a library of the present invention is as follows: figure 1 shown. Specific steps are as follows:
[0088] 1. Calculation of amplification efficiency of internal reference genes in the genome
[0089] (1) Homogenize the genomic DNA samples of human tissue or peripheral blood to 20ng / ul, and take 2ul for reaction. The samples in the present invention include genomic DNA derived from peripheral blood of patients diagnosed as mitochondria-related disease LHON and peripheral blood genomic DNA of normal people.
[0090] (2) Prepare the reaction solution according to the formula in Table 1 (taking the internal reference gene amplification primer HK-PCR3 as an example), the primer sequence is as follows:
[0091] HK-PCR3_F: TCAGCGGTTCCGCACATC (sequence 1);
[0092] HK-PCR3_R: CTGCAGATAGGAAGGGCTTTGT (SEQ ID NO: 2).
[0093] Table 1. Reaction ...
Embodiment 2
[0219] Example 2, the detection method of mitochondrial copy number and sequence variation
[0220] Detect the mitochondrial copy number and sequence variation of the genomic DNA of the sample to be tested in Example 1. Steps 1-5 and 7-12 are the same as in Example 1, and only the enzyme in Step 6 is interrupted. Replace it with the method of building a library by physical interruption. The method of building a library by physical interruption is as follows:
[0221] (1) Take the mixed sample of mitochondria in 5 ul prepared in step 5 of Example 1 and add TE to make up to a total volume of 80 ul, add it to a 96-well 200 ul Axygen PCR plate, and mix well to obtain a reaction system. The reaction system is according to Table 18. The reaction was carried out under the conditions shown to obtain the reaction product.
[0222] Table 18. Reaction conditions
[0223]
[0224] (2) After the reaction is completed, use 120ul Ampure XP magnetic beads to purify the reaction product, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



