Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method for mitochondrial copy number and sequence variation

A mitochondrial and copy number technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as large differences between batches, unsuitable for large-scale detection, and low throughput

Inactive Publication Date: 2019-10-29
SHENZHEN HUADA GENE INST
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The present invention aims to solve the technical problems of low throughput, large batch-to-batch variation, and unsuitability for large-scale detection of mitochondrial DNA copy number detection in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for mitochondrial copy number and sequence variation
  • Detection method for mitochondrial copy number and sequence variation
  • Detection method for mitochondrial copy number and sequence variation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1. Detection method of mitochondrial copy number and sequence variation

[0087] The flow process of the method for building a library of the present invention is as follows: figure 1 shown. Specific steps are as follows:

[0088] 1. Calculation of amplification efficiency of internal reference genes in the genome

[0089] (1) Homogenize the genomic DNA samples of human tissue or peripheral blood to 20ng / ul, and take 2ul for reaction. The samples in the present invention include genomic DNA derived from peripheral blood of patients diagnosed as mitochondria-related disease LHON and peripheral blood genomic DNA of normal people.

[0090] (2) Prepare the reaction solution according to the formula in Table 1 (taking the internal reference gene amplification primer HK-PCR3 as an example), the primer sequence is as follows:

[0091] HK-PCR3_F: TCAGCGGTTCCGCACATC (sequence 1);

[0092] HK-PCR3_R: CTGCAGATAGGAAGGGCTTTGT (SEQ ID NO: 2).

[0093] Table 1. Reaction ...

Embodiment 2

[0219] Example 2, the detection method of mitochondrial copy number and sequence variation

[0220] Detect the mitochondrial copy number and sequence variation of the genomic DNA of the sample to be tested in Example 1. Steps 1-5 and 7-12 are the same as in Example 1, and only the enzyme in Step 6 is interrupted. Replace it with the method of building a library by physical interruption. The method of building a library by physical interruption is as follows:

[0221] (1) Take the mixed sample of mitochondria in 5 ul prepared in step 5 of Example 1 and add TE to make up to a total volume of 80 ul, add it to a 96-well 200 ul Axygen PCR plate, and mix well to obtain a reaction system. The reaction system is according to Table 18. The reaction was carried out under the conditions shown to obtain the reaction product.

[0222] Table 18. Reaction conditions

[0223]

[0224] (2) After the reaction is completed, use 120ul Ampure XP magnetic beads to purify the reaction product, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection method for mitochondrial copy number and sequence variation. Based on a BGI-Seq series sequencing platform, a high-flux, low-cost and automated mitochondrial variation detection technology is established, and the technology comprises mitochondrial whole-genome DNA separation and genome housekeeping gene amplification, library construction and sequencing, and supporting information analysis algorithm development. The technology can simultaneously achieve mitochondrial copy number variation and sequence variation detection, and is high in flux, small in difference between batches, high in accuracy, low in cost, short in used time, and capable of fully meeting the need of automated production. The technology can be applied to mtDNA somaclonal variation research and detection, diagnosis of mitochondrion related diseases, research of the role, played in the aging process, of mitochondria, tumor cell metabolic activity related research and the like, and has good prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting mitochondrial copy number and sequence variation. Background technique [0002] All human somatic cells, except red blood cells, contain mitochondria, which are important organelles in eukaryotic cells. Mitochondria mainly carry out functions such as biological oxidation and energy conversion, so 95% of the energy produced by cells comes from the oxidative phosphorylation process in mitochondria. In addition, mitochondria also support and participate in many important cellular functions, such as mediating metabolism, maintaining ion homeostasis, synthesis of lipids, nucleic acids and amino acids, cell proliferation and initiation of apoptosis, etc. Mitochondria have their own genetic system, namely mitochondrial DNA, which is the only extranuclear genetic material in the cell, which can autonomously replicate, transcribe and translate, and has a ve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869C12Q1/6806C12N15/11
CPCC12Q1/6806C12Q1/6869C12Q2531/113C12Q2545/101C12Q2537/16
Inventor 阮婕聂超张现东
Owner SHENZHEN HUADA GENE INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com