Detection method for mitochondrial copy number and sequence variation
A mitochondrial and copy number technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as large differences between batches, unsuitable for large-scale detection, and low throughput
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1. Detection method of mitochondrial copy number and sequence variation
[0087] The flow process of the method for building a library of the present invention is as follows: figure 1 shown. Specific steps are as follows:
[0088] 1. Calculation of amplification efficiency of internal reference genes in the genome
[0089] (1) Homogenize the genomic DNA samples of human tissue or peripheral blood to 20ng / ul, and take 2ul for reaction. The samples in the present invention include genomic DNA derived from peripheral blood of patients diagnosed as mitochondria-related disease LHON and peripheral blood genomic DNA of normal people.
[0090] (2) Prepare the reaction solution according to the formula in Table 1 (taking the internal reference gene amplification primer HK-PCR3 as an example), the primer sequence is as follows:
[0091] HK-PCR3_F: TCAGCGGTTCCGCACATC (sequence 1);
[0092] HK-PCR3_R: CTGCAGATAGGAAGGGCTTTGT (SEQ ID NO: 2).
[0093] Table 1. Reaction ...
Embodiment 2
[0219] Example 2, the detection method of mitochondrial copy number and sequence variation
[0220] Detect the mitochondrial copy number and sequence variation of the genomic DNA of the sample to be tested in Example 1. Steps 1-5 and 7-12 are the same as in Example 1, and only the enzyme in Step 6 is interrupted. Replace it with the method of building a library by physical interruption. The method of building a library by physical interruption is as follows:
[0221] (1) Take the mixed sample of mitochondria in 5 ul prepared in step 5 of Example 1 and add TE to make up to a total volume of 80 ul, add it to a 96-well 200 ul Axygen PCR plate, and mix well to obtain a reaction system. The reaction system is according to Table 18. The reaction was carried out under the conditions shown to obtain the reaction product.
[0222] Table 18. Reaction conditions
[0223]
[0224] (2) After the reaction is completed, use 120ul Ampure XP magnetic beads to purify the reaction product, ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com