Unlock instant, AI-driven research and patent intelligence for your innovation.

Wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and application thereof

A technology of wild strawberries and strawberries, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of lack of maturity and restrict the development of strawberry industry, and achieve the effect of promoting early ripening of strawberry fruits

Inactive Publication Date: 2019-11-01
NORTHWEST A & F UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The domestic shortage of strawberry varieties that mature early and have good quality restricts the development of my country's strawberry industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and application thereof
  • Wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and application thereof
  • Wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Cloning and sequence analysis of the fruit ripening gene FvTCP9 of wild strawberry Heilongjiang-3

[0035] The total RNA of ‘Heilongjiang-3’ strawberry leaves was extracted with the OMEGA Plant RNA Kit, and the extraction steps were carried out according to the instructions of the kit. According to the PrimeScriptTM RT reagentKit with gDNA Eraser (Perfect Real Time) reverse transcription kit from TaKaRa Company, the first-strand cDNA was synthesized by RNA reverse transcription, and the method was referred to the kit instructions. According to a transcription factor gene sequence published by NCBI (Genbank accession number: XM_004301030.2), use Vector NTI software to design specific primers, upstream primer: FvTCP9-F: 5'CTATCTGATCTCTCTCTTTCTCTCCA3' (SEQ ID NO: 4), downstream primer: FvTCP9-R: 5'AAATCCATTATGAGTACTACTGTTGTA3'(SEQ ID NO:5), using the leaf cDNA of 'Heilongjiang-3' as a template, and using the high-fidelity enzyme PrimeSTAR HS DNA Polymerase for P...

Embodiment 2

[0037] Example 2: Expression Analysis of FvTCP9 Gene in Different Tissues

[0038] The inventors used real-time fluorescent quantitative PCR technology to detect the expression of FvTCP9 gene in seven tissues of wild strawberry Heilongjiang-3: root, stem, leaf, flower, green fruit, ginkgo fruit and red fruit.

[0039] The following real-time fluorescent quantitative PCR detection primers were designed according to the FvTCP9 gene sequence:

[0040] FvTCP9-qF: 5' CCACCACCACCCACCACCATGAG 3' (SEQ ID NO: 2)

[0041] FvTCP9-qR: 5'TGTTGTTGTTGTTGCTGCTGCTGC 3' (SEQ ID NO: 3)

[0042] FvACTIN-qF: 5'TGGGTTTGCTGGAGATGAT 3' (SEQ ID NO: 6)

[0043] FvACTIN-qR: 5'CAGTAGGAGAACTGGGTGC 3' (SEQ ID NO:7)

[0044] RT-qPCR experiments were performed on a Bio-Rad IQ5 real-time fluorescent quantitative PCR instrument using TaKaRa's real-time fluorescent quantitative PCR kit. The reaction system is: SYBR Premix Ex Taq II 10.5 μL, cDNA template 1.0 μL, Forward-primer 0.8 μL, Reverse-primer 0.8 μL,...

Embodiment 3

[0046] Example 3: FvTCP9 gene overexpression, silencing vector construction and acquisition of transient fruit

[0047] Overexpression vector construction: design gene-specific primers with BamHI restriction site, upstream primer: FvTCP9-C15-F: 5'TCTGATCAAGAGACA GGATCC ATGTTTCCTTTATAGCTCAAAC GTTTT 3' (SEQ ID NO: 8), downstream primer: FvTCP9-C15-R: 5'GCCCTTGCTCACCAT GGATCC AAATCCATTATGAGTACTACTGTTGTAG3' (SEQ ID NO: 9) (the underline font indicates the BamHI restriction site), and the coding sequence of FvTCP9 was amplified with the pMD18T-FvTCP9 plasmid as a template, using The PCR one-step directional cloning kit (seamless cloning) was connected to the plant overexpression vector C15 containing the YFP tag at an appropriate molar ratio through a homologous recombination reaction to construct a fusion overexpression vector 35S::FvTCP9-YFP. The 35S::FvTCP9-YFP plasmid was transformed into Agrobacterium competent cells GV3101 by electroporation, and the C15 empty vector was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and application thereof. The gene sequence is shown in SEQ ID NO: 1. The wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 confirms that the FvTCP9 gene is transiently expressed in a cultivated strawberry fruit, and finds that overexpression of FvTCP9 can promote fruit ripening and increase the content of ABA, anthocyanin and soluble sugar in the fruit, while silencing FvTCP9 inhibites fruit ripening. A flowering phase of transgenic Arabidopsis with overexpression of FvTCP9 is advanced. The FvTCP9 genehas important significance for genetic improvement of strawberry fruit quality and improvement of strawberry fruit quality.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering for plant fruit ripening gene identification, and in particular relates to a wild strawberry Heilongjiang-3 fruit ripening gene FvTCP9 and its application. Background technique [0002] Strawberry is rich in nutrition and is a berry fruit with important economic value. At present, in production, it is mainly realized through facility cultivation that it goes on the market ahead of time in anti-season, so as to improve the economic benefits of strawberries. The domestic shortage of strawberry varieties that mature early and have good quality restricts the development of my country's strawberry industry. Therefore, it is of great theoretical and practical significance to carry out functional research on candidate genes related to strawberry fruit ripening and quality for the future use of these genes for genetic improvement of strawberry fruit ripening and quality. [0003] Fruit ripen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/08A01H6/74
CPCC07K14/415C12N15/8245C12N15/825C12N15/8261
Inventor 冯嘉玥文颖强谢尹歌马阳阳
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More